EMAIL THIS PAGE TO A FRIEND

FUCA1

fucosidase, alpha-L- 1, tissue

81 Gene Product Result for
Synonyms: FUCA
UniProtKB ID: P04066, Q14334, Q14335, Q3LID0, Q8NAC2
Gene ID:
Human(2517) Summary: The protein encoded by this gene is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in this gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. A pseudogene of this locus is present on chr 2.[provided by RefSeq, Oct 2009]
Mouse(71665) fucosidase, alpha-L- 1, tissue
Rat(24375) fucosidase, alpha-L- 1, tissue
Zebrafish(335494) fucosidase, alpha-L- 1, tissue
dog(403929) fucosidase, alpha-L- 1, tissue
Horse(100071543) fucosidase, alpha-L- 1, tissue
cow(509522) fucosidase, alpha-L- 1, tissue
domestic cat(101099988) fucosidase, alpha-L- 1, tissue
chicken(419687) fucosidase, alpha-L- 1, tissue
sheep(101119449) fucosidase, alpha-L- 1, tissue
Domestic Rabbit(100357404) fucosidase, alpha-L- 1, tissue
domestic guinea pig(100721805) fucosidase, alpha-L- 1, tissue
naked mole-rat(101717431) fucosidase, alpha-L- 1, tissue
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000147 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000147 Rosetta Predictions human pricing
NM_012562 Rosetta Predictions rat pricing
NM_024243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057940 predicted 1401
2 SASI_Hs01_00057941 predicted 1503
3 SASI_Hs01_00057942 predicted 576
4 SASI_Hs01_00057943 predicted 1292
5 SASI_Hs01_00057944 predicted 700
6 SASI_Hs01_00057945 predicted 1414
7 SASI_Hs01_00057946 predicted 1297
8 SASI_Hs01_00057947 predicted 471
9 SASI_Hs02_00301963 predicted 559
10 SASI_Hs01_00057948 predicted 956
11 SASI_Hs01_00057939 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113445 predicted 990
2 SASI_Rn01_00113446 predicted 485
3 SASI_Rn01_00113447 predicted 583
4 SASI_Rn01_00113448 predicted 313
5 SASI_Rn01_00113449 predicted 1155
6 SASI_Rn01_00113450 predicted 1208
7 SASI_Rn02_00259673 predicted 967
8 SASI_Rn01_00113451 predicted 998
9 SASI_Rn01_00113452 predicted 1170
10 SASI_Rn01_00113453 predicted 709
11 SASI_Rn01_00113454 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327621 predicted 519
2 SASI_Mm01_00065454 predicted 1516
3 SASI_Mm01_00065455 predicted 1025
4 SASI_Mm01_00065457 predicted 1083
5 SASI_Mm01_00065459 predicted 1293
6 SASI_Mm01_00065460 predicted 605
7 SASI_Mm01_00065461 predicted 1005
8 SASI_Mm01_00065462 predicted 439
9 SASI_Mm02_00327622 predicted 697
10 SASI_Mm01_00065463 predicted 789
11 SASI_Mm01_00065456 predicted 1156
12 SASI_Mm01_00065458 predicted 1439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024243
VALIDATED
FUCA1 MISSION shRNA Bacterial Glycerol Stock
fucosidase, alpha-L- 1, tissue
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024243.4-1473s21c1
Sequence:CCGGGCTTACCATCCCTGCAATAAACTCGAGTTTATTGCAGGGATGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-1045s21c1
Sequence:CCGGCTCAACATTGGACCAACTAAACTCGAGTTTAGTTGGTCCAATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024243.4-673s21c1
Sequence:CCGGCCAGAGCTGTATGACCTTGTTCTCGAGAACAAGGTCATACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-1288s21c1
Sequence:CCGGGCCACAAAGATAACAATGCTACTCGAGTAGCATTGTTATCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-796s21c1
Sequence:CCGGCCTGTCAAGGATGAGGTGATACTCGAGTATCACCTCATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024243.2-1626s1c1
Sequence:CCGGCCTGATAATGAGCCAAGTCATCTCGAGATGACTTGGCTCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-1258s1c1
Sequence:CCGGGCCACAAAGATAACAATGCTACTCGAGTAGCATTGTTATCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-644s1c1
Sequence:CCGGCAGAGCTGTATGACCTTGTTACTCGAGTAACAAGGTCATACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024243.2-643s1c1
Sequence:CCGGCCAGAGCTGTATGACCTTGTTCTCGAGAACAAGGTCATACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-766s1c1
Sequence:CCGGCCTGTCAAGGATGAGGTGATACTCGAGTATCACCTCATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024243
VALIDATED
FUCA1 MISSION shRNA shRNA Plasmid DNA
fucosidase, alpha-L- 1, tissue
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024243.4-1473s21c1
Sequence:CCGGGCTTACCATCCCTGCAATAAACTCGAGTTTATTGCAGGGATGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-1045s21c1
Sequence:CCGGCTCAACATTGGACCAACTAAACTCGAGTTTAGTTGGTCCAATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024243.4-673s21c1
Sequence:CCGGCCAGAGCTGTATGACCTTGTTCTCGAGAACAAGGTCATACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-1288s21c1
Sequence:CCGGGCCACAAAGATAACAATGCTACTCGAGTAGCATTGTTATCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-796s21c1
Sequence:CCGGCCTGTCAAGGATGAGGTGATACTCGAGTATCACCTCATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024243.2-1626s1c1
Sequence:CCGGCCTGATAATGAGCCAAGTCATCTCGAGATGACTTGGCTCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-1258s1c1
Sequence:CCGGGCCACAAAGATAACAATGCTACTCGAGTAGCATTGTTATCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-644s1c1
Sequence:CCGGCAGAGCTGTATGACCTTGTTACTCGAGTAACAAGGTCATACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024243.2-643s1c1
Sequence:CCGGCCAGAGCTGTATGACCTTGTTCTCGAGAACAAGGTCATACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-766s1c1
Sequence:CCGGCCTGTCAAGGATGAGGTGATACTCGAGTATCACCTCATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024243
VALIDATED
FUCA1 MISSION shRNA Lentiviral Transduction Particles
fucosidase, alpha-L- 1, tissue
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024243.4-1473s21c1
Sequence:CCGGGCTTACCATCCCTGCAATAAACTCGAGTTTATTGCAGGGATGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-1045s21c1
Sequence:CCGGCTCAACATTGGACCAACTAAACTCGAGTTTAGTTGGTCCAATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024243.4-673s21c1
Sequence:CCGGCCAGAGCTGTATGACCTTGTTCTCGAGAACAAGGTCATACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-1288s21c1
Sequence:CCGGGCCACAAAGATAACAATGCTACTCGAGTAGCATTGTTATCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024243.4-796s21c1
Sequence:CCGGCCTGTCAAGGATGAGGTGATACTCGAGTATCACCTCATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024243.2-1626s1c1
Sequence:CCGGCCTGATAATGAGCCAAGTCATCTCGAGATGACTTGGCTCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-1258s1c1
Sequence:CCGGGCCACAAAGATAACAATGCTACTCGAGTAGCATTGTTATCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-644s1c1
Sequence:CCGGCAGAGCTGTATGACCTTGTTACTCGAGTAACAAGGTCATACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024243.2-643s1c1
Sequence:CCGGCCAGAGCTGTATGACCTTGTTCTCGAGAACAAGGTCATACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024243.2-766s1c1
Sequence:CCGGCCTGTCAAGGATGAGGTGATACTCGAGTATCACCTCATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000147
VALIDATED
FUCA1 MISSION shRNA Bacterial Glycerol Stock
fucosidase, alpha-L- 1, tissue
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000147.3-1292s21c1
Sequence:CCGGCCTCAACTACAAAGATAACAACTCGAGTTGTTATCTTTGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000147.3-1404s21c1
Sequence:CCGGCGCAGAGTTTGCTTGGACTATCTCGAGATAGTCCAAGCAAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000147.3-1600s21c1
Sequence:CCGGCTGATGTCTAAATGGACCAAACTCGAGTTTGGTCCATTTAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000147.3-715s21c1
Sequence:CCGGCCTGATCTGATCTGGTCTGATCTCGAGATCAGACCAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000147.2-1558s1c1
Sequence:CCGGCTGATGTCTAAATGGACCAAACTCGAGTTTGGTCCATTTAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-673s1c1
Sequence:CCGGCCTGATCTGATCTGGTCTGATCTCGAGATCAGACCAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-1250s1c1
Sequence:CCGGCCTCAACTACAAAGATAACAACTCGAGTTGTTATCTTTGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-549s1c1
Sequence:CCGGCCACTCACTCTTAGAGTGGTTCTCGAGAACCACTCTAAGAGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-1362s1c1
Sequence:CCGGCGCAGAGTTTGCTTGGACTATCTCGAGATAGTCCAAGCAAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000147
VALIDATED
FUCA1 MISSION shRNA shRNA Plasmid DNA
fucosidase, alpha-L- 1, tissue
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000147.3-1292s21c1
Sequence:CCGGCCTCAACTACAAAGATAACAACTCGAGTTGTTATCTTTGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000147.3-1404s21c1
Sequence:CCGGCGCAGAGTTTGCTTGGACTATCTCGAGATAGTCCAAGCAAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000147.3-1600s21c1
Sequence:CCGGCTGATGTCTAAATGGACCAAACTCGAGTTTGGTCCATTTAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000147.3-715s21c1
Sequence:CCGGCCTGATCTGATCTGGTCTGATCTCGAGATCAGACCAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000147.2-1558s1c1
Sequence:CCGGCTGATGTCTAAATGGACCAAACTCGAGTTTGGTCCATTTAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-673s1c1
Sequence:CCGGCCTGATCTGATCTGGTCTGATCTCGAGATCAGACCAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-1250s1c1
Sequence:CCGGCCTCAACTACAAAGATAACAACTCGAGTTGTTATCTTTGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-549s1c1
Sequence:CCGGCCACTCACTCTTAGAGTGGTTCTCGAGAACCACTCTAAGAGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-1362s1c1
Sequence:CCGGCGCAGAGTTTGCTTGGACTATCTCGAGATAGTCCAAGCAAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000147
VALIDATED
FUCA1 MISSION shRNA Lentiviral Transduction Particles
fucosidase, alpha-L- 1, tissue
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000147.3-1292s21c1
Sequence:CCGGCCTCAACTACAAAGATAACAACTCGAGTTGTTATCTTTGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000147.3-1404s21c1
Sequence:CCGGCGCAGAGTTTGCTTGGACTATCTCGAGATAGTCCAAGCAAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000147.3-1600s21c1
Sequence:CCGGCTGATGTCTAAATGGACCAAACTCGAGTTTGGTCCATTTAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000147.3-715s21c1
Sequence:CCGGCCTGATCTGATCTGGTCTGATCTCGAGATCAGACCAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000147.2-1558s1c1
Sequence:CCGGCTGATGTCTAAATGGACCAAACTCGAGTTTGGTCCATTTAGACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-673s1c1
Sequence:CCGGCCTGATCTGATCTGGTCTGATCTCGAGATCAGACCAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-1250s1c1
Sequence:CCGGCCTCAACTACAAAGATAACAACTCGAGTTGTTATCTTTGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-549s1c1
Sequence:CCGGCCACTCACTCTTAGAGTGGTTCTCGAGAACCACTCTAAGAGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000147.2-1362s1c1
Sequence:CCGGCGCAGAGTTTGCTTGGACTATCTCGAGATAGTCCAAGCAAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks