EMAIL THIS PAGE TO A FRIEND

FUK

fucokinase

75 Gene Product Result for
Synonyms: 1110046B12Rik
UniProtKB ID: Q8N0W3, Q5PSM3, Q5XKL6, Q6ZRA0, Q96MT9
Gene ID:
Human(197258) Summary: The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Mouse(234730) fucokinase
Rat(307848) fucokinase
chicken(770049) fucokinase
dog(489715) fucokinase
cow(519181) fucokinase
Horse(100054844) fucokinase
sheep(101114636) fucokinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145059 Rosetta Predictions human pricing
NM_001107429 Rosetta Predictions rat pricing
NM_172283 Rosetta Predictions mouse pricing
NM_181666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205675 predicted 520
2 SASI_Hs02_00364957 predicted 3298
3 SASI_Hs01_00205676 predicted 997
4 SASI_Hs01_00205677 predicted 674
5 SASI_Hs01_00205678 predicted 3409
6 SASI_Hs01_00205679 predicted 602
7 SASI_Hs01_00205680 predicted 609
8 SASI_Hs01_00205682 predicted 875
9 SASI_Hs02_00364958 predicted 3406
10 SASI_Hs01_00205684 predicted 2085
11 SASI_Hs01_00205681 predicted 2121
12 SASI_Hs01_00205683 predicted 2723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228735 predicted 3173
2 SASI_Rn02_00228736 predicted 2517
3 SASI_Rn02_00228737 predicted 323
4 SASI_Rn02_00228738 predicted 2454
5 SASI_Rn02_00228739 predicted 1954
6 SASI_Rn02_00228740 predicted 1016
7 SASI_Rn02_00228741 predicted 879
8 SASI_Rn02_00228742 predicted 3154
9 SASI_Rn02_00228743 predicted 2460
10 SASI_Rn02_00228744 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170266 predicted 2514
2 SASI_Mm01_00170267 predicted 1253
3 SASI_Mm01_00170268 predicted 2239
4 SASI_Mm01_00170269 predicted 677
5 SASI_Mm01_00170270 predicted 2405
6 SASI_Mm01_00170271 predicted 671
7 SASI_Mm01_00170272 predicted 877
8 SASI_Mm01_00170273 predicted 1103
9 SASI_Mm01_00170274 predicted 873
10 SASI_Mm01_00170275 predicted 2411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076049 predicted 2520
2 SASI_Mm01_00076050 predicted 1256
3 SASI_Mm01_00076051 predicted 2242
4 SASI_Mm01_00076052 predicted 679
5 SASI_Mm01_00076053 predicted 2410
6 SASI_Mm01_00076054 predicted 664
7 SASI_Mm01_00076055 predicted 877
8 SASI_Mm01_00076056 predicted 1103
9 SASI_Mm01_00076057 predicted 876
10 SASI_Mm01_00076058 predicted 2409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145059
VALIDATED
FUK MISSION shRNA Bacterial Glycerol Stock
fucokinase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145059.2-936s21c1
Sequence:CCGGATGCAGATGTAGCGGGTTATCCTCGAGGATAACCCGCTACATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145059.2-3550s21c1
Sequence:CCGGTAGTATCCCACGTGGCCTTTACTCGAGTAAAGGCCACGTGGGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145059.2-2713s21c1
Sequence:CCGGGGACCAAGTAGGTGGCCTAATCTCGAGATTAGGCCACCTACTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145059.2-3697s21c1
Sequence:CCGGGGCTTAGAGTTGTAGACTTACCTCGAGGTAAGTCTACAACTCTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145059.2-3207s1c1
Sequence:CCGGCCGAGGGCCTTGGGAATTACACTCGAGTGTAATTCCCAAGGCCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145059.2-449s1c1
Sequence:CCGGCTGGACATCATGACCTATCGGCTCGAGCCGATAGGTCATGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145059.1-934s1c1
Sequence:CCGGGATGCAGATGTAGCGGGTTATCTCGAGATAACCCGCTACATCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-525s1c1
Sequence:CCGGTGTTCCTGCAAATCCTGGTATCTCGAGATACCAGGATTTGCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-2953s1c1
Sequence:CCGGCAAACTGAGGAGTGTGCTGAACTCGAGTTCAGCACACTCCTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-3135s1c1
Sequence:CCGGTGGAGGCTTTCTCTATCTGTTCTCGAGAACAGATAGAGAAAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-1966s1c1
Sequence:CCGGCCCTTCTCATACCTGGAGTGTCTCGAGACACTCCAGGTATGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145059
VALIDATED
FUK MISSION shRNA shRNA Plasmid DNA
fucokinase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145059.2-936s21c1
Sequence:CCGGATGCAGATGTAGCGGGTTATCCTCGAGGATAACCCGCTACATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145059.2-3550s21c1
Sequence:CCGGTAGTATCCCACGTGGCCTTTACTCGAGTAAAGGCCACGTGGGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145059.2-2713s21c1
Sequence:CCGGGGACCAAGTAGGTGGCCTAATCTCGAGATTAGGCCACCTACTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145059.2-3697s21c1
Sequence:CCGGGGCTTAGAGTTGTAGACTTACCTCGAGGTAAGTCTACAACTCTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145059.2-3207s1c1
Sequence:CCGGCCGAGGGCCTTGGGAATTACACTCGAGTGTAATTCCCAAGGCCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145059.2-449s1c1
Sequence:CCGGCTGGACATCATGACCTATCGGCTCGAGCCGATAGGTCATGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145059.1-934s1c1
Sequence:CCGGGATGCAGATGTAGCGGGTTATCTCGAGATAACCCGCTACATCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-525s1c1
Sequence:CCGGTGTTCCTGCAAATCCTGGTATCTCGAGATACCAGGATTTGCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-2953s1c1
Sequence:CCGGCAAACTGAGGAGTGTGCTGAACTCGAGTTCAGCACACTCCTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-3135s1c1
Sequence:CCGGTGGAGGCTTTCTCTATCTGTTCTCGAGAACAGATAGAGAAAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-1966s1c1
Sequence:CCGGCCCTTCTCATACCTGGAGTGTCTCGAGACACTCCAGGTATGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145059
VALIDATED
FUK MISSION shRNA Lentiviral Transduction Particles
fucokinase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145059.2-936s21c1
Sequence:CCGGATGCAGATGTAGCGGGTTATCCTCGAGGATAACCCGCTACATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145059.2-3550s21c1
Sequence:CCGGTAGTATCCCACGTGGCCTTTACTCGAGTAAAGGCCACGTGGGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145059.2-2713s21c1
Sequence:CCGGGGACCAAGTAGGTGGCCTAATCTCGAGATTAGGCCACCTACTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145059.2-3697s21c1
Sequence:CCGGGGCTTAGAGTTGTAGACTTACCTCGAGGTAAGTCTACAACTCTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145059.2-3207s1c1
Sequence:CCGGCCGAGGGCCTTGGGAATTACACTCGAGTGTAATTCCCAAGGCCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145059.2-449s1c1
Sequence:CCGGCTGGACATCATGACCTATCGGCTCGAGCCGATAGGTCATGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145059.1-934s1c1
Sequence:CCGGGATGCAGATGTAGCGGGTTATCTCGAGATAACCCGCTACATCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-525s1c1
Sequence:CCGGTGTTCCTGCAAATCCTGGTATCTCGAGATACCAGGATTTGCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-2953s1c1
Sequence:CCGGCAAACTGAGGAGTGTGCTGAACTCGAGTTCAGCACACTCCTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-3135s1c1
Sequence:CCGGTGGAGGCTTTCTCTATCTGTTCTCGAGAACAGATAGAGAAAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_145059.1-1966s1c1
Sequence:CCGGCCCTTCTCATACCTGGAGTGTCTCGAGACACTCCAGGTATGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172283
FUK MISSION shRNA Bacterial Glycerol Stock
fucokinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-869s21c1
Sequence:CCGGCTCTGCATGGCTCGGAATATGCTCGAGCATATTCCGAGCCATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-1353s21c1
Sequence:CCGGGCTCCCTGAGCCGTGTATTTACTCGAGTAAATACACGGCTCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-2834s21c1
Sequence:CCGGGACCATCTGCTCCTGGTTTATCTCGAGATAAACCAGGAGCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-794s21c1
Sequence:CCGGCTGGATGCCTGCACCTATATGCTCGAGCATATAGGTGCAGGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-2507s1c1
Sequence:CCGGGAACAGTTGTTACACTCCTTTCTCGAGAAAGGAGTGTAACAACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-2456s1c1
Sequence:CCGGGCCTTTATCTGTGCTGGCATTCTCGAGAATGCCAGCACAGATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-1257s1c1
Sequence:CCGGGCTTTGTGAGTGGTCTGGATACTCGAGTATCCAGACCACTCACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-94s1c1
Sequence:CCGGCATTATCCTGACATGCCAGTACTCGAGTACTGGCATGTCAGGATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-3145s1c1
Sequence:CCGGCTTTCTCTATCTATTGACCAACTCGAGTTGGTCAATAGATAGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172283
FUK MISSION shRNA shRNA Plasmid DNA
fucokinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-869s21c1
Sequence:CCGGCTCTGCATGGCTCGGAATATGCTCGAGCATATTCCGAGCCATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-1353s21c1
Sequence:CCGGGCTCCCTGAGCCGTGTATTTACTCGAGTAAATACACGGCTCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-2834s21c1
Sequence:CCGGGACCATCTGCTCCTGGTTTATCTCGAGATAAACCAGGAGCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-794s21c1
Sequence:CCGGCTGGATGCCTGCACCTATATGCTCGAGCATATAGGTGCAGGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-2507s1c1
Sequence:CCGGGAACAGTTGTTACACTCCTTTCTCGAGAAAGGAGTGTAACAACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-2456s1c1
Sequence:CCGGGCCTTTATCTGTGCTGGCATTCTCGAGAATGCCAGCACAGATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-1257s1c1
Sequence:CCGGGCTTTGTGAGTGGTCTGGATACTCGAGTATCCAGACCACTCACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-94s1c1
Sequence:CCGGCATTATCCTGACATGCCAGTACTCGAGTACTGGCATGTCAGGATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-3145s1c1
Sequence:CCGGCTTTCTCTATCTATTGACCAACTCGAGTTGGTCAATAGATAGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172283
FUK MISSION shRNA Lentiviral Transduction Particles
fucokinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-869s21c1
Sequence:CCGGCTCTGCATGGCTCGGAATATGCTCGAGCATATTCCGAGCCATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-1353s21c1
Sequence:CCGGGCTCCCTGAGCCGTGTATTTACTCGAGTAAATACACGGCTCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-2834s21c1
Sequence:CCGGGACCATCTGCTCCTGGTTTATCTCGAGATAAACCAGGAGCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172283.2-794s21c1
Sequence:CCGGCTGGATGCCTGCACCTATATGCTCGAGCATATAGGTGCAGGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-2507s1c1
Sequence:CCGGGAACAGTTGTTACACTCCTTTCTCGAGAAAGGAGTGTAACAACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-2456s1c1
Sequence:CCGGGCCTTTATCTGTGCTGGCATTCTCGAGAATGCCAGCACAGATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-1257s1c1
Sequence:CCGGGCTTTGTGAGTGGTCTGGATACTCGAGTATCCAGACCACTCACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-94s1c1
Sequence:CCGGCATTATCCTGACATGCCAGTACTCGAGTACTGGCATGTCAGGATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172283.2-3145s1c1
Sequence:CCGGCTTTCTCTATCTATTGACCAACTCGAGTTGGTCAATAGATAGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks