EMAIL THIS PAGE TO A FRIEND

FUNDC1

FUN14 domain containing 1

71 Gene Product Result for
UniProtKB ID: Q8IVP5
Gene ID:
Human(139341) Summary: This gene encodes a protein with a FUN14 superfamily domain. The function of the encoded protein is not known. [provided by RefSeq, Sep 2011]
Mouse(72018) FUN14 domain containing 1
Rat(363442) FUN14 domain containing 1
Zebrafish(436984) FUN14 domain containing 1
domestic cat(101092745) FUN14 domain containing 1
cow(518258) FUN14 domain containing 1
dog(491842) FUN14 domain containing 1
chicken(418558) FUN14 domain containing 1
domestic guinea pig(100730729) FUN14 domain containing 1
sheep(101107165) FUN14 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53280 Anti-FUNDC1 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, canine, bovine, mouse, rabbit, human, rat, horse,
western blot pricing
AV53281 Anti-FUNDC1 (AB2) antibody produced in rabbit affinity isolated antibody bovine, horse, human, canine, rat, zebrafish, rabbit, guinea pig, mouse
western blot pricing
HPA038773 Anti-FUNDC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173794 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173794 Rosetta Predictions human pricing
NM_001025027 Rosetta Predictions rat pricing
NM_028058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077808 predicted 192
2 SASI_Hs01_00077809 predicted 649
3 SASI_Hs01_00077810 predicted 287
4 SASI_Hs01_00077811 predicted 198
5 SASI_Hs01_00077812 predicted 481
6 SASI_Hs01_00077813 predicted 502
7 SASI_Hs01_00077814 predicted 403
8 SASI_Hs01_00077815 predicted 527
9 SASI_Hs01_00077816 predicted 276
10 SASI_Hs02_00368648 predicted 602
11 SASI_Hs01_00077817 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091190 predicted 458
2 SASI_Rn01_00091191 predicted 276
3 SASI_Rn01_00091192 predicted 494
4 SASI_Rn01_00091193 predicted 777
5 SASI_Rn01_00091194 predicted 801
6 SASI_Rn01_00091195 predicted 772
7 SASI_Rn01_00091196 predicted 796
8 SASI_Rn01_00091197 predicted 867
9 SASI_Rn01_00091198 predicted 792
10 SASI_Rn01_00091199 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049693 predicted 450
2 SASI_Mm01_00049694 predicted 622
3 SASI_Mm01_00049695 predicted 260
4 SASI_Mm02_00333251 predicted 473
5 SASI_Mm01_00049696 predicted 403
6 SASI_Mm01_00049697 predicted 382
7 SASI_Mm01_00049698 predicted 262
8 SASI_Mm01_00049699 predicted 584
9 SASI_Mm01_00049700 predicted 681
10 SASI_Mm01_00049701 predicted 770
11 SASI_Mm01_00049702 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173794
VALIDATED
FUNDC1 MISSION shRNA Bacterial Glycerol Stock
FUN14 domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-328s1c1
Sequence:CCGGGCAGGATTTCTGTTCCAGAAACTCGAGTTTCTGGAACAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-474s1c1
Sequence:CCGGGATTAAGAAACGAGCGAACAACTCGAGTTGTTCGCTCGTTTCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-172s1c1
Sequence:CCGGGAAAGTGATGACGACTCTTATCTCGAGATAAGAGTCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-399s1c1
Sequence:CCGGGATTGCTAGTCATAGTGGCTACTCGAGTAGCCACTATGACTAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-391s1c1
Sequence:CCGGCTTCTTCAGATTGCTAGTCATCTCGAGATGACTAGCAATCTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-497s1c1
Sequence:CCGGCAGCACCTGAAATCAACAATTCTCGAGAATTGTTGATTTCAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-769s1c1
Sequence:CCGGGCAAACTAGTATCTGCTGTAACTCGAGTTACAGCAGATACTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-708s1c1
Sequence:CCGGGAGAAACAACTAGCTGGACAACTCGAGTTGTCCAGCTAGTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173794.3-262s21c1
Sequence:CCGGGTTCGGGACCTATGGTAGAAACTCGAGTTTCTACCATAGGTCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173794.3-591s21c1
Sequence:CCGGTTGCTCGGACTTGCATCTTAACTCGAGTTAAGATGCAAGTCCGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173794
VALIDATED
FUNDC1 MISSION shRNA shRNA Plasmid DNA
FUN14 domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-328s1c1
Sequence:CCGGGCAGGATTTCTGTTCCAGAAACTCGAGTTTCTGGAACAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-474s1c1
Sequence:CCGGGATTAAGAAACGAGCGAACAACTCGAGTTGTTCGCTCGTTTCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-172s1c1
Sequence:CCGGGAAAGTGATGACGACTCTTATCTCGAGATAAGAGTCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-399s1c1
Sequence:CCGGGATTGCTAGTCATAGTGGCTACTCGAGTAGCCACTATGACTAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-391s1c1
Sequence:CCGGCTTCTTCAGATTGCTAGTCATCTCGAGATGACTAGCAATCTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-497s1c1
Sequence:CCGGCAGCACCTGAAATCAACAATTCTCGAGAATTGTTGATTTCAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-769s1c1
Sequence:CCGGGCAAACTAGTATCTGCTGTAACTCGAGTTACAGCAGATACTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-708s1c1
Sequence:CCGGGAGAAACAACTAGCTGGACAACTCGAGTTGTCCAGCTAGTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173794.3-262s21c1
Sequence:CCGGGTTCGGGACCTATGGTAGAAACTCGAGTTTCTACCATAGGTCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173794.3-591s21c1
Sequence:CCGGTTGCTCGGACTTGCATCTTAACTCGAGTTAAGATGCAAGTCCGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173794
VALIDATED
FUNDC1 MISSION shRNA Lentiviral Transduction Particles
FUN14 domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-328s1c1
Sequence:CCGGGCAGGATTTCTGTTCCAGAAACTCGAGTTTCTGGAACAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-474s1c1
Sequence:CCGGGATTAAGAAACGAGCGAACAACTCGAGTTGTTCGCTCGTTTCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-172s1c1
Sequence:CCGGGAAAGTGATGACGACTCTTATCTCGAGATAAGAGTCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-399s1c1
Sequence:CCGGGATTGCTAGTCATAGTGGCTACTCGAGTAGCCACTATGACTAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-391s1c1
Sequence:CCGGCTTCTTCAGATTGCTAGTCATCTCGAGATGACTAGCAATCTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173794.2-497s1c1
Sequence:CCGGCAGCACCTGAAATCAACAATTCTCGAGAATTGTTGATTTCAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-769s1c1
Sequence:CCGGGCAAACTAGTATCTGCTGTAACTCGAGTTACAGCAGATACTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173794.2-708s1c1
Sequence:CCGGGAGAAACAACTAGCTGGACAACTCGAGTTGTCCAGCTAGTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173794.3-262s21c1
Sequence:CCGGGTTCGGGACCTATGGTAGAAACTCGAGTTTCTACCATAGGTCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173794.3-591s21c1
Sequence:CCGGTTGCTCGGACTTGCATCTTAACTCGAGTTAAGATGCAAGTCCGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028058
VALIDATED
FUNDC1 MISSION shRNA Bacterial Glycerol Stock
FUN14 domain containing 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.1-208s1c1
Sequence:CCGGCCACTGGTGGAATCGAGTATTCTCGAGAATACTCGATTCCACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.1-404s1c1
Sequence:CCGGCAGATCGACTGGAAGAGAGTTCTCGAGAACTCTCTTCCAGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-450s1c1
Sequence:CCGGGACAGATAAAGAAGCGAGCAACTCGAGTTGCTCGCTTCTTTATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-476s1c1
Sequence:CCGGGCAGCACCTGAAATCAACAATCTCGAGATTGTTGATTTCAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-454s1c1
Sequence:CCGGGATAAAGAAGCGAGCAAATAACTCGAGTTATTTGCTCGCTTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-515s1c1
Sequence:CCGGGACTTTATCAAGCAGAACATTCTCGAGAATGTTCTGCTTGATAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-745s1c1
Sequence:CCGGCCAAGCTAGTATCTCCTGTAACTCGAGTTACAGGAGATACTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028058.3-744s21c1
Sequence:CCGGCCAAGCTAGTATCTCCTGTAACTCGAGTTACAGGAGATACTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-514s21c1
Sequence:CCGGGACTTTATCAAGCAGAACATTCTCGAGAATGTTCTGCTTGATAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-475s21c1
Sequence:CCGGGCAGCACCTGAAATCAACAATCTCGAGATTGTTGATTTCAGGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.3-263s1c1
Sequence:CCGGCAGTAGCTACTCAGATTGTAACTCGAGTTACAATCTGAGTAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-453s21c1
Sequence:CCGGGATAAAGAAGCGAGCAAATAACTCGAGTTATTTGCTCGCTTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028058
VALIDATED
FUNDC1 MISSION shRNA shRNA Plasmid DNA
FUN14 domain containing 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.1-208s1c1
Sequence:CCGGCCACTGGTGGAATCGAGTATTCTCGAGAATACTCGATTCCACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.1-404s1c1
Sequence:CCGGCAGATCGACTGGAAGAGAGTTCTCGAGAACTCTCTTCCAGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-450s1c1
Sequence:CCGGGACAGATAAAGAAGCGAGCAACTCGAGTTGCTCGCTTCTTTATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-476s1c1
Sequence:CCGGGCAGCACCTGAAATCAACAATCTCGAGATTGTTGATTTCAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-454s1c1
Sequence:CCGGGATAAAGAAGCGAGCAAATAACTCGAGTTATTTGCTCGCTTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-515s1c1
Sequence:CCGGGACTTTATCAAGCAGAACATTCTCGAGAATGTTCTGCTTGATAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-745s1c1
Sequence:CCGGCCAAGCTAGTATCTCCTGTAACTCGAGTTACAGGAGATACTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028058.3-744s21c1
Sequence:CCGGCCAAGCTAGTATCTCCTGTAACTCGAGTTACAGGAGATACTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-514s21c1
Sequence:CCGGGACTTTATCAAGCAGAACATTCTCGAGAATGTTCTGCTTGATAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-475s21c1
Sequence:CCGGGCAGCACCTGAAATCAACAATCTCGAGATTGTTGATTTCAGGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.3-263s1c1
Sequence:CCGGCAGTAGCTACTCAGATTGTAACTCGAGTTACAATCTGAGTAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-453s21c1
Sequence:CCGGGATAAAGAAGCGAGCAAATAACTCGAGTTATTTGCTCGCTTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028058
VALIDATED
FUNDC1 MISSION shRNA Lentiviral Transduction Particles
FUN14 domain containing 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.1-208s1c1
Sequence:CCGGCCACTGGTGGAATCGAGTATTCTCGAGAATACTCGATTCCACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.1-404s1c1
Sequence:CCGGCAGATCGACTGGAAGAGAGTTCTCGAGAACTCTCTTCCAGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-450s1c1
Sequence:CCGGGACAGATAAAGAAGCGAGCAACTCGAGTTGCTCGCTTCTTTATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-476s1c1
Sequence:CCGGGCAGCACCTGAAATCAACAATCTCGAGATTGTTGATTTCAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-454s1c1
Sequence:CCGGGATAAAGAAGCGAGCAAATAACTCGAGTTATTTGCTCGCTTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-515s1c1
Sequence:CCGGGACTTTATCAAGCAGAACATTCTCGAGAATGTTCTGCTTGATAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028058.1-745s1c1
Sequence:CCGGCCAAGCTAGTATCTCCTGTAACTCGAGTTACAGGAGATACTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028058.3-744s21c1
Sequence:CCGGCCAAGCTAGTATCTCCTGTAACTCGAGTTACAGGAGATACTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-514s21c1
Sequence:CCGGGACTTTATCAAGCAGAACATTCTCGAGAATGTTCTGCTTGATAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-475s21c1
Sequence:CCGGGCAGCACCTGAAATCAACAATCTCGAGATTGTTGATTTCAGGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028058.3-263s1c1
Sequence:CCGGCAGTAGCTACTCAGATTGTAACTCGAGTTACAATCTGAGTAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028058.3-453s21c1
Sequence:CCGGGATAAAGAAGCGAGCAAATAACTCGAGTTATTTGCTCGCTTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks