EMAIL THIS PAGE TO A FRIEND

FUNDC2

FUN14 domain containing 2

88 Gene Product Result for
Synonyms: DC44 HCBP6 HCC3 PD03104
UniProtKB ID: Q9BWH2, B2R7W5, D3DWY5, Q8NHX8, Q9H2I6
Gene ID:
Mouse(67391) FUN14 domain containing 2
Rat(361288) FUN14 domain containing 2
sheep(101104126) FUN14 domain containing 2
Domestic Rabbit(100328769) FUN14 domain containing 2
domestic guinea pig(100720567) FUN14 domain containing 2
naked mole-rat(101721988) FUN14 domain containing 2
Zebrafish(792181) fun14 domain containing 2
chicken(422200) FUN14 domain containing 2
domestic cat(101093005) FUN14 domain containing 2
cow(281813) FUN14 domain containing 2
dog(613014) FUN14 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023934 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023934 Rosetta Predictions human pricing
XM_001059050 Rosetta Predictions rat pricing
XM_001059114 Rosetta Predictions rat pricing
XM_341573 Rosetta Predictions rat pricing
NM_026126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141822 predicted 343
2 SASI_Hs01_00141823 predicted 434
3 SASI_Hs01_00141824 predicted 963
4 SASI_Hs01_00141825 predicted 282
5 SASI_Hs01_00141826 predicted 846
6 SASI_Hs01_00141827 predicted 846
7 SASI_Hs01_00141828 predicted 883
8 SASI_Hs01_00141829 predicted 599
9 SASI_Hs01_00141830 predicted 997
10 SASI_Hs01_00141831 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291748 predicted 229
2 SASI_Rn02_00291749 predicted 524
3 SASI_Rn02_00291750 predicted 478
4 SASI_Rn02_00291751 predicted 553
5 SASI_Rn02_00291752 predicted 213
6 SASI_Rn02_00291753 predicted 521
7 SASI_Rn02_00291754 predicted 538
8 SASI_Rn02_00291755 predicted 226
9 SASI_Rn02_00291756 predicted 258
10 SASI_Rn02_00291757 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292024 predicted 491
2 SASI_Rn02_00292025 predicted 479
3 SASI_Rn02_00292026 predicted 319
4 SASI_Rn02_00292027 predicted 514
5 SASI_Rn02_00292028 predicted 214
6 SASI_Rn02_00292029 predicted 427
7 SASI_Rn02_00292030 predicted 443
8 SASI_Rn02_00292031 predicted 207
9 SASI_Rn02_00292032 predicted 498
10 SASI_Rn02_00292033 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393119 predicted 489
2 SASI_Rn02_00393120 predicted 483
3 SASI_Rn02_00393121 predicted 194
4 SASI_Rn02_00393122 predicted 322
5 SASI_Rn02_00393123 predicted 219
6 SASI_Rn02_00393124 predicted 422
7 SASI_Rn02_00393125 predicted 448
8 SASI_Rn02_00393126 predicted 217
9 SASI_Rn02_00393127 predicted 499
10 SASI_Rn02_00393128 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168479 predicted 626
2 SASI_Mm01_00168480 predicted 404
3 SASI_Mm01_00168481 predicted 663
4 SASI_Mm01_00168482 predicted 756
5 SASI_Mm01_00168483 predicted 513
6 SASI_Mm01_00168484 predicted 462
7 SASI_Mm01_00168485 predicted 700
8 SASI_Mm01_00168486 predicted 588
9 SASI_Mm01_00168487 predicted 691
10 SASI_Mm02_00329705 predicted 470
11 SASI_Mm01_00168488 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026126
VALIDATED
FUNDC2 MISSION shRNA Bacterial Glycerol Stock
FUN14 domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-145s21c1
Sequence:CCGGTAGCAACCCAGCTGGTAATTGCTCGAGCAATTACCAGCTGGGTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026126.3-1793s21c1
Sequence:CCGGATAACCAGCCTTGGTATATATCTCGAGATATATACCAAGGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-179s21c1
Sequence:CCGGATGGTGCACTGGTTTCGTATTCTCGAGAATACGAAACCAGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026126.3-60s1c1
Sequence:CCGGGATCTTGCAGAATTAACTAAACTCGAGTTTAGTTAATTCTGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-60s21c1
Sequence:CCGGGATCTTGCAGAATTAACTAAACTCGAGTTTAGTTAATTCTGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-229s21c1
Sequence:CCGGATGTAGGAGGTGGATTCTTTCCTCGAGGAAAGAATCCACCTCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026126.2-641s1c1
Sequence:CCGGGCCTTCTCAATTTAACACGTTCTCGAGAACGTGTTAAATTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026126.2-347s1c1
Sequence:CCGGGAATAAGCAAATACCAACTGACTCGAGTCAGTTGGTATTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026126.2-1261s1c1
Sequence:CCGGCCAGGCATTCAGAATAAGAATCTCGAGATTCTTATTCTGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026126
VALIDATED
FUNDC2 MISSION shRNA shRNA Plasmid DNA
FUN14 domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-145s21c1
Sequence:CCGGTAGCAACCCAGCTGGTAATTGCTCGAGCAATTACCAGCTGGGTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026126.3-1793s21c1
Sequence:CCGGATAACCAGCCTTGGTATATATCTCGAGATATATACCAAGGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-179s21c1
Sequence:CCGGATGGTGCACTGGTTTCGTATTCTCGAGAATACGAAACCAGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026126.3-60s1c1
Sequence:CCGGGATCTTGCAGAATTAACTAAACTCGAGTTTAGTTAATTCTGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-60s21c1
Sequence:CCGGGATCTTGCAGAATTAACTAAACTCGAGTTTAGTTAATTCTGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-229s21c1
Sequence:CCGGATGTAGGAGGTGGATTCTTTCCTCGAGGAAAGAATCCACCTCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026126.2-641s1c1
Sequence:CCGGGCCTTCTCAATTTAACACGTTCTCGAGAACGTGTTAAATTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026126.2-347s1c1
Sequence:CCGGGAATAAGCAAATACCAACTGACTCGAGTCAGTTGGTATTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026126.2-1261s1c1
Sequence:CCGGCCAGGCATTCAGAATAAGAATCTCGAGATTCTTATTCTGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026126
VALIDATED
FUNDC2 MISSION shRNA Lentiviral Transduction Particles
FUN14 domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-145s21c1
Sequence:CCGGTAGCAACCCAGCTGGTAATTGCTCGAGCAATTACCAGCTGGGTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026126.3-1793s21c1
Sequence:CCGGATAACCAGCCTTGGTATATATCTCGAGATATATACCAAGGCTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-179s21c1
Sequence:CCGGATGGTGCACTGGTTTCGTATTCTCGAGAATACGAAACCAGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026126.3-60s1c1
Sequence:CCGGGATCTTGCAGAATTAACTAAACTCGAGTTTAGTTAATTCTGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-60s21c1
Sequence:CCGGGATCTTGCAGAATTAACTAAACTCGAGTTTAGTTAATTCTGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026126.3-229s21c1
Sequence:CCGGATGTAGGAGGTGGATTCTTTCCTCGAGGAAAGAATCCACCTCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026126.2-641s1c1
Sequence:CCGGGCCTTCTCAATTTAACACGTTCTCGAGAACGTGTTAAATTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026126.2-347s1c1
Sequence:CCGGGAATAAGCAAATACCAACTGACTCGAGTCAGTTGGTATTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026126.2-1261s1c1
Sequence:CCGGCCAGGCATTCAGAATAAGAATCTCGAGATTCTTATTCTGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023934
VALIDATED
FUNDC2 MISSION shRNA Bacterial Glycerol Stock
FUN14 domain containing 2
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-431s21c1
Sequence:CCGGGATGGTGCACAGGTTTCATATCTCGAGATATGAAACCTGTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-246s21c1
Sequence:CCGGGCGAGACAAGCTCACCGAAATCTCGAGATTTCGGTGAGCTTGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-520s21c1
Sequence:GTACCGGCATACTGGGTACATCAAAGTTCTCGAGAACTTTGATGTACCCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023934.3-2508s21c1
Sequence:CCGGTGCAAGGTTCACATCGTATTTCTCGAGAAATACGATGTGAACCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-307s21c1
Sequence:CCGGTCACTGGACCTTGCGGAATTTCTCGAGAAATTCCGCAAGGTCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-330s1c1
Sequence:CCGGGAATCTGGACCTTCAGCAGAACTCGAGTTCTGCTGAAGGTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-548s1c1
Sequence:CCGGGCTGAAGATCCGTAAGAGCAACTCGAGTTGCTCTTACGGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-285s1c1
Sequence:CCGGGAATTTGCTAAGAAGCAGCCACTCGAGTGGCTGCTTCTTAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-554s1c1
Sequence:CCGGGATCCGTAAGAGCAATCAGATCTCGAGATCTGATTGCTCTTACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-401s1c1
Sequence:CCGGCACAGGTTTCATATTCCAGAACTCGAGTTCTGGAATATGAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023934.2-243s1c1
Sequence:CCGGCAAGGAAACTTTGAGGGAAATCTCGAGATTTCCCTCAAAGTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-400s1c1
Sequence:CCGGGCACAGGTTTCATATTCCAGACTCGAGTCTGGAATATGAAACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-394s1c1
Sequence:CCGGGATGGTGCACAGGTTTCATATCTCGAGATATGAAACCTGTGCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-521s1c1
Sequence:CCGGGAAGGACATGAAGAAAGCCAACTCGAGTTGGCTTTCTTCATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-473s1c1
Sequence:CCGGGCTTGCAAACCATACTGGGTACTCGAGTACCCAGTATGGTTTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-533s1c1
Sequence:CCGGGAAAGCCAAAGAGCAGCTGAACTCGAGTTCAGCTGCTCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-234s1c1
Sequence:CCGGGCGTCCAGTCAAGGAAACTTTCTCGAGAAAGTTTCCTTGACTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023934
VALIDATED
FUNDC2 MISSION shRNA shRNA Plasmid DNA
FUN14 domain containing 2
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-431s21c1
Sequence:CCGGGATGGTGCACAGGTTTCATATCTCGAGATATGAAACCTGTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-246s21c1
Sequence:CCGGGCGAGACAAGCTCACCGAAATCTCGAGATTTCGGTGAGCTTGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-520s21c1
Sequence:GTACCGGCATACTGGGTACATCAAAGTTCTCGAGAACTTTGATGTACCCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023934.3-2508s21c1
Sequence:CCGGTGCAAGGTTCACATCGTATTTCTCGAGAAATACGATGTGAACCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-307s21c1
Sequence:CCGGTCACTGGACCTTGCGGAATTTCTCGAGAAATTCCGCAAGGTCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-330s1c1
Sequence:CCGGGAATCTGGACCTTCAGCAGAACTCGAGTTCTGCTGAAGGTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-548s1c1
Sequence:CCGGGCTGAAGATCCGTAAGAGCAACTCGAGTTGCTCTTACGGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-285s1c1
Sequence:CCGGGAATTTGCTAAGAAGCAGCCACTCGAGTGGCTGCTTCTTAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-554s1c1
Sequence:CCGGGATCCGTAAGAGCAATCAGATCTCGAGATCTGATTGCTCTTACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-401s1c1
Sequence:CCGGCACAGGTTTCATATTCCAGAACTCGAGTTCTGGAATATGAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023934.2-243s1c1
Sequence:CCGGCAAGGAAACTTTGAGGGAAATCTCGAGATTTCCCTCAAAGTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-400s1c1
Sequence:CCGGGCACAGGTTTCATATTCCAGACTCGAGTCTGGAATATGAAACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-394s1c1
Sequence:CCGGGATGGTGCACAGGTTTCATATCTCGAGATATGAAACCTGTGCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-521s1c1
Sequence:CCGGGAAGGACATGAAGAAAGCCAACTCGAGTTGGCTTTCTTCATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-473s1c1
Sequence:CCGGGCTTGCAAACCATACTGGGTACTCGAGTACCCAGTATGGTTTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-533s1c1
Sequence:CCGGGAAAGCCAAAGAGCAGCTGAACTCGAGTTCAGCTGCTCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-234s1c1
Sequence:CCGGGCGTCCAGTCAAGGAAACTTTCTCGAGAAAGTTTCCTTGACTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023934
VALIDATED
FUNDC2 MISSION shRNA Lentiviral Transduction Particles
FUN14 domain containing 2
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-431s21c1
Sequence:CCGGGATGGTGCACAGGTTTCATATCTCGAGATATGAAACCTGTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-246s21c1
Sequence:CCGGGCGAGACAAGCTCACCGAAATCTCGAGATTTCGGTGAGCTTGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-520s21c1
Sequence:GTACCGGCATACTGGGTACATCAAAGTTCTCGAGAACTTTGATGTACCCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023934.3-2508s21c1
Sequence:CCGGTGCAAGGTTCACATCGTATTTCTCGAGAAATACGATGTGAACCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023934.3-307s21c1
Sequence:CCGGTCACTGGACCTTGCGGAATTTCTCGAGAAATTCCGCAAGGTCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-330s1c1
Sequence:CCGGGAATCTGGACCTTCAGCAGAACTCGAGTTCTGCTGAAGGTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-548s1c1
Sequence:CCGGGCTGAAGATCCGTAAGAGCAACTCGAGTTGCTCTTACGGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-285s1c1
Sequence:CCGGGAATTTGCTAAGAAGCAGCCACTCGAGTGGCTGCTTCTTAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-554s1c1
Sequence:CCGGGATCCGTAAGAGCAATCAGATCTCGAGATCTGATTGCTCTTACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-401s1c1
Sequence:CCGGCACAGGTTTCATATTCCAGAACTCGAGTTCTGGAATATGAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023934.2-243s1c1
Sequence:CCGGCAAGGAAACTTTGAGGGAAATCTCGAGATTTCCCTCAAAGTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-400s1c1
Sequence:CCGGGCACAGGTTTCATATTCCAGACTCGAGTCTGGAATATGAAACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-394s1c1
Sequence:CCGGGATGGTGCACAGGTTTCATATCTCGAGATATGAAACCTGTGCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-521s1c1
Sequence:CCGGGAAGGACATGAAGAAAGCCAACTCGAGTTGGCTTTCTTCATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-473s1c1
Sequence:CCGGGCTTGCAAACCATACTGGGTACTCGAGTACCCAGTATGGTTTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023934.2-533s1c1
Sequence:CCGGGAAAGCCAAAGAGCAGCTGAACTCGAGTTCAGCTGCTCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_023934.2-234s1c1
Sequence:CCGGGCGTCCAGTCAAGGAAACTTTCTCGAGAAAGTTTCCTTGACTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks