EMAIL THIS PAGE TO A FRIEND

FUNDC2P2

FUN14 domain containing 2 pseudogene 2

22 Gene Product Result for
Species: Human FUNDC2P2(388965)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013648 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013648 Rosetta Predictions human pricing
NR_003663 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215067 predicted 650
2 SASI_Hs01_00215068 predicted 780
3 SASI_Hs01_00215069 predicted 727
4 SASI_Hs01_00215070 predicted 726
5 SASI_Hs01_00215071 predicted 761
6 SASI_Hs01_00215072 predicted 838
7 SASI_Hs01_00215073 predicted 846
8 SASI_Hs01_00215074 predicted 224
9 SASI_Hs01_00215075 predicted 468
10 SASI_Hs01_00215076 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379993 predicted 638
2 SASI_Hs02_00379994 predicted 716
3 SASI_Hs02_00379995 predicted 774
4 SASI_Hs02_00379996 predicted 807
5 SASI_Hs02_00379997 predicted 481
6 SASI_Hs02_00379998 predicted 770
7 SASI_Hs02_00379999 predicted 683
8 SASI_Hs02_00380000 predicted 1373
9 SASI_Hs02_00380001 predicted 971
10 SASI_Hs02_00380002 predicted 1483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013648
FUNDC2P2 MISSION shRNA Bacterial Glycerol Stock
FUN14 domain containing 2 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-430s1c1
Sequence:CCGGGAAGGACATGAAGAAAGCCAACTCGAGTTGGCTTTCTTCATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-463s1c1
Sequence:CCGGGATCCCTAAGAGCACTCAGATCTCGAGATCTGAGTGCTCTTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-442s1c1
Sequence:CCGGGAAAGCCAAAGAGCAGCTGAACTCGAGTTCAGCTGCTCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-170s1c1
Sequence:CCGGGATATTGAGTCAGTGGACCTTCTCGAGAAGGTCCACTGACTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-221s1c1
Sequence:CCGGCGTAAGCTGTTTGGGCCAGAACTCGAGTTCTGGCCCAAACAGCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013648
FUNDC2P2 MISSION shRNA shRNA Plasmid DNA
FUN14 domain containing 2 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-430s1c1
Sequence:CCGGGAAGGACATGAAGAAAGCCAACTCGAGTTGGCTTTCTTCATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-463s1c1
Sequence:CCGGGATCCCTAAGAGCACTCAGATCTCGAGATCTGAGTGCTCTTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-442s1c1
Sequence:CCGGGAAAGCCAAAGAGCAGCTGAACTCGAGTTCAGCTGCTCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-170s1c1
Sequence:CCGGGATATTGAGTCAGTGGACCTTCTCGAGAAGGTCCACTGACTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-221s1c1
Sequence:CCGGCGTAAGCTGTTTGGGCCAGAACTCGAGTTCTGGCCCAAACAGCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013648
FUNDC2P2 MISSION shRNA Lentiviral Transduction Particles
FUN14 domain containing 2 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-430s1c1
Sequence:CCGGGAAGGACATGAAGAAAGCCAACTCGAGTTGGCTTTCTTCATGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-463s1c1
Sequence:CCGGGATCCCTAAGAGCACTCAGATCTCGAGATCTGAGTGCTCTTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-442s1c1
Sequence:CCGGGAAAGCCAAAGAGCAGCTGAACTCGAGTTCAGCTGCTCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-170s1c1
Sequence:CCGGGATATTGAGTCAGTGGACCTTCTCGAGAAGGTCCACTGACTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013648.1-221s1c1
Sequence:CCGGCGTAAGCTGTTTGGGCCAGAACTCGAGTTCTGGCCCAAACAGCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks