EMAIL THIS PAGE TO A FRIEND

FUOM

fucose mutarotase

71 Gene Product Result for
Synonyms: C10orf125 FUCU FucM
UniProtKB ID: A2VDF0, A1L300, Q5VWY2, Q5VWY3, Q6ZPD2
Gene ID:
Mouse(69064) fucose mutarotase
Rat(293587) fucose mutarotase
Zebrafish(447896) fucose mutarotase
domestic cat(101083804) fucose mutarotase
cow(613571) chromosome 26 open reading frame, human C10orf125
dog(491696) fucose mutarotase
naked mole-rat(101698158) fucose mutarotase
domestic guinea pig(100725704) fucose mutarotase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198472 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120971 MISSION® esiRNA esiRNA human C10orf125 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098483 Rosetta Predictions human pricing
NM_198472 Rosetta Predictions human pricing
NM_001106310 Rosetta Predictions rat pricing
XM_215110 Rosetta Predictions rat pricing
NM_026928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318979 predicted 337
2 SASI_Hs02_00318980 predicted 302
3 SASI_Hs02_00318981 predicted 316
4 SASI_Hs02_00318982 predicted 288
5 SASI_Hs02_00318983 predicted 297
6 SASI_Hs02_00318984 predicted 330
7 SASI_Hs02_00318985 predicted 333
8 SASI_Hs02_00318986 predicted 328
9 SASI_Hs02_00318987 predicted 229
10 SASI_Hs02_00318988 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109135 predicted 356
2 SASI_Hs01_00109136 predicted 478
3 SASI_Hs02_00372005 predicted 329
4 SASI_Hs01_00109137 predicted 342
5 SASI_Hs01_00109138 predicted 297
6 SASI_Hs01_00109139 predicted 292
7 SASI_Hs01_00109141 predicted 341
8 SASI_Hs01_00109142 predicted 329
9 SASI_Hs02_00372006 predicted 230
10 SASI_Hs01_00109143 predicted 394
11 SASI_Hs01_00109140 predicted 506
12 SASI_Hs01_00109144 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217718 predicted 916
2 SASI_Rn02_00217719 predicted 763
3 SASI_Rn02_00217720 predicted 557
4 SASI_Rn02_00217721 predicted 1142
5 SASI_Rn02_00217722 predicted 995
6 SASI_Rn02_00217723 predicted 706
7 SASI_Rn02_00217724 predicted 1015
8 SASI_Rn02_00217725 predicted 1063
9 SASI_Rn02_00217726 predicted 536
10 SASI_Rn02_00217727 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136254 predicted 482
2 SASI_Rn01_00136255 predicted 332
3 SASI_Rn01_00136256 predicted 305
4 SASI_Rn01_00136257 predicted 483
5 SASI_Rn01_00136258 predicted 482
6 SASI_Rn01_00136259 predicted 417
7 SASI_Rn01_00136260 predicted 278
8 SASI_Rn01_00136261 predicted 282
9 SASI_Rn01_00136262 predicted 291
10 SASI_Rn01_00136263 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331220 predicted 337
2 SASI_Mm02_00331221 predicted 313
3 SASI_Mm01_00192062 predicted 388
4 SASI_Mm02_00331222 predicted 339
5 SASI_Mm01_00192064 predicted 339
6 SASI_Mm01_00192065 predicted 380
7 SASI_Mm01_00192066 predicted 343
8 SASI_Mm01_00192068 predicted 290
9 SASI_Mm02_00331223 predicted 341
10 SASI_Mm01_00192069 predicted 295
11 SASI_Mm01_00192063 predicted 686
12 SASI_Mm01_00192067 predicted 473
13 SASI_Mm01_00192070 predicted 352
14 SASI_Mm01_00192071 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026928
VALIDATED
FUOM MISSION shRNA Bacterial Glycerol Stock
fucose mutarotase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026928.1-726s1c1
Sequence:CCGGCCTGATGAAGCTAGAGAGATTCTCGAGAATCTCTCTAGCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026928.1-825s1c1
Sequence:CCGGCAAGAAGGGAACTCTTGACCTCTCGAGAGGTCAAGAGTTCCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-466s1c1
Sequence:CCGGGAGGGAGACGAAATTGTCCTTCTCGAGAAGGACAATTTCGTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-684s1c1
Sequence:CCGGGCGTTATGAATCCCTTCTTCTCTCGAGAGAAGAAGGGATTCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-674s1c1
Sequence:CCGGCGATATGGAAGCGTTATGAATCTCGAGATTCATAACGCTTCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-681s1c1
Sequence:CCGGGAAGCGTTATGAATCCCTTCTCTCGAGAGAAGGGATTCATAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-350s21c1
Sequence:CCGGTGAAGCTAGAGAGATTTGAATCTCGAGATTCAAATCTCTCTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-458s21c1
Sequence:CCGGTTGACCTCGGACCCTCATAGACTCGAGTCTATGAGGGTCCGAGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-100s21c1
Sequence:CCGGGTCCTTGCTGATGCGAACTTCCTCGAGGAAGTTCGCATCAGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-303s21c1
Sequence:CCGGGCGTTATGAATCCCTTCTTCTCTCGAGAGAAGAAGGGATTCATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-293s21c1
Sequence:CCGGCGATATGGAAGCGTTATGAATCTCGAGATTCATAACGCTTCCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026928
VALIDATED
FUOM MISSION shRNA shRNA Plasmid DNA
fucose mutarotase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026928.1-726s1c1
Sequence:CCGGCCTGATGAAGCTAGAGAGATTCTCGAGAATCTCTCTAGCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026928.1-825s1c1
Sequence:CCGGCAAGAAGGGAACTCTTGACCTCTCGAGAGGTCAAGAGTTCCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-466s1c1
Sequence:CCGGGAGGGAGACGAAATTGTCCTTCTCGAGAAGGACAATTTCGTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-684s1c1
Sequence:CCGGGCGTTATGAATCCCTTCTTCTCTCGAGAGAAGAAGGGATTCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-674s1c1
Sequence:CCGGCGATATGGAAGCGTTATGAATCTCGAGATTCATAACGCTTCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-681s1c1
Sequence:CCGGGAAGCGTTATGAATCCCTTCTCTCGAGAGAAGGGATTCATAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-350s21c1
Sequence:CCGGTGAAGCTAGAGAGATTTGAATCTCGAGATTCAAATCTCTCTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-458s21c1
Sequence:CCGGTTGACCTCGGACCCTCATAGACTCGAGTCTATGAGGGTCCGAGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-100s21c1
Sequence:CCGGGTCCTTGCTGATGCGAACTTCCTCGAGGAAGTTCGCATCAGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-303s21c1
Sequence:CCGGGCGTTATGAATCCCTTCTTCTCTCGAGAGAAGAAGGGATTCATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-293s21c1
Sequence:CCGGCGATATGGAAGCGTTATGAATCTCGAGATTCATAACGCTTCCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026928
VALIDATED
FUOM MISSION shRNA Lentiviral Transduction Particles
fucose mutarotase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026928.1-726s1c1
Sequence:CCGGCCTGATGAAGCTAGAGAGATTCTCGAGAATCTCTCTAGCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026928.1-825s1c1
Sequence:CCGGCAAGAAGGGAACTCTTGACCTCTCGAGAGGTCAAGAGTTCCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-466s1c1
Sequence:CCGGGAGGGAGACGAAATTGTCCTTCTCGAGAAGGACAATTTCGTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-684s1c1
Sequence:CCGGGCGTTATGAATCCCTTCTTCTCTCGAGAGAAGAAGGGATTCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-674s1c1
Sequence:CCGGCGATATGGAAGCGTTATGAATCTCGAGATTCATAACGCTTCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026928.1-681s1c1
Sequence:CCGGGAAGCGTTATGAATCCCTTCTCTCGAGAGAAGGGATTCATAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-350s21c1
Sequence:CCGGTGAAGCTAGAGAGATTTGAATCTCGAGATTCAAATCTCTCTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-458s21c1
Sequence:CCGGTTGACCTCGGACCCTCATAGACTCGAGTCTATGAGGGTCCGAGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-100s21c1
Sequence:CCGGGTCCTTGCTGATGCGAACTTCCTCGAGGAAGTTCGCATCAGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-303s21c1
Sequence:CCGGGCGTTATGAATCCCTTCTTCTCTCGAGAGAAGAAGGGATTCATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026928.2-293s21c1
Sequence:CCGGCGATATGGAAGCGTTATGAATCTCGAGATTCATAACGCTTCCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198472
VALIDATED
FUOM MISSION shRNA Bacterial Glycerol Stock
fucose mutarotase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198472.1-99s1c1
Sequence:CCGGGATCGTTCTTGCGGACTTGAACTCGAGTTCAAGTCCGCAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198472.2-545s21c1
Sequence:CCGGTGCTGTAGGCCTGGTGAAGACCTCGAGGTCTTCACCAGGCCTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-597s21c1
Sequence:CCGGCTGAGCTCCAGTACCACCACTCTCGAGAGTGGTGGTACTGGAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-220s21c1
Sequence:CCGGCTGGACACCTATGTGGAGAGTCTCGAGACTCTCCACATAGGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-352s21c1
Sequence:CCGGGCAAAGATAGAGAGGTTTGAGCTCGAGCTCAAACCTCTCTATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-398s21c1
Sequence:CCGGTTGCTGTTGTGGCAACGGGATCTCGAGATCCCGTTGCCACAACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-304s21c1
Sequence:CCGGACGGAGTACGAGTCCATCCTACTCGAGTAGGATGGACTCGTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-378s21c1
Sequence:CCGGTGAACGGGCTAAGAAGGCTTTCTCGAGAAAGCCTTCTTAGCCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-497s21c1
Sequence:CCGGTCTACGGAAACCTCATCCTCACTCGAGTGAGGATGAGGTTTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-341s21c1
Sequence:CCGGTGAGAGCCCTGGCAAAGATAGCTCGAGCTATCTTTGCCAGGGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-98s21c1
Sequence:CCGGAGATCGTTCTTGCGGACTTGACTCGAGTCAAGTCCGCAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198472
VALIDATED
FUOM MISSION shRNA shRNA Plasmid DNA
fucose mutarotase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198472.1-99s1c1
Sequence:CCGGGATCGTTCTTGCGGACTTGAACTCGAGTTCAAGTCCGCAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198472.2-545s21c1
Sequence:CCGGTGCTGTAGGCCTGGTGAAGACCTCGAGGTCTTCACCAGGCCTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-597s21c1
Sequence:CCGGCTGAGCTCCAGTACCACCACTCTCGAGAGTGGTGGTACTGGAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-220s21c1
Sequence:CCGGCTGGACACCTATGTGGAGAGTCTCGAGACTCTCCACATAGGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-352s21c1
Sequence:CCGGGCAAAGATAGAGAGGTTTGAGCTCGAGCTCAAACCTCTCTATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-398s21c1
Sequence:CCGGTTGCTGTTGTGGCAACGGGATCTCGAGATCCCGTTGCCACAACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-304s21c1
Sequence:CCGGACGGAGTACGAGTCCATCCTACTCGAGTAGGATGGACTCGTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-378s21c1
Sequence:CCGGTGAACGGGCTAAGAAGGCTTTCTCGAGAAAGCCTTCTTAGCCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-497s21c1
Sequence:CCGGTCTACGGAAACCTCATCCTCACTCGAGTGAGGATGAGGTTTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-341s21c1
Sequence:CCGGTGAGAGCCCTGGCAAAGATAGCTCGAGCTATCTTTGCCAGGGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-98s21c1
Sequence:CCGGAGATCGTTCTTGCGGACTTGACTCGAGTCAAGTCCGCAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198472
VALIDATED
FUOM MISSION shRNA Lentiviral Transduction Particles
fucose mutarotase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198472.1-99s1c1
Sequence:CCGGGATCGTTCTTGCGGACTTGAACTCGAGTTCAAGTCCGCAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198472.2-545s21c1
Sequence:CCGGTGCTGTAGGCCTGGTGAAGACCTCGAGGTCTTCACCAGGCCTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-597s21c1
Sequence:CCGGCTGAGCTCCAGTACCACCACTCTCGAGAGTGGTGGTACTGGAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-220s21c1
Sequence:CCGGCTGGACACCTATGTGGAGAGTCTCGAGACTCTCCACATAGGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-352s21c1
Sequence:CCGGGCAAAGATAGAGAGGTTTGAGCTCGAGCTCAAACCTCTCTATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-398s21c1
Sequence:CCGGTTGCTGTTGTGGCAACGGGATCTCGAGATCCCGTTGCCACAACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-304s21c1
Sequence:CCGGACGGAGTACGAGTCCATCCTACTCGAGTAGGATGGACTCGTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-378s21c1
Sequence:CCGGTGAACGGGCTAAGAAGGCTTTCTCGAGAAAGCCTTCTTAGCCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-497s21c1
Sequence:CCGGTCTACGGAAACCTCATCCTCACTCGAGTGAGGATGAGGTTTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-341s21c1
Sequence:CCGGTGAGAGCCCTGGCAAAGATAGCTCGAGCTATCTTTGCCAGGGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198472.2-98s21c1
Sequence:CCGGAGATCGTTCTTGCGGACTTGACTCGAGTCAAGTCCGCAAGAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks