EMAIL THIS PAGE TO A FRIEND

FURIN

furin (paired basic amino acid cleaving enzyme)

149 Gene Product Result for
Synonyms: FUR PACE PCSK3 SPC1
UniProtKB ID: P09958, Q14336, Q6LBS3, Q9UCZ5
Gene ID:
Human(5045) Summary: The protein encoded by this gene belongs to the subtilisin-like proprotein convertase family. The members of this family are proprotein convertases that process latent precursor proteins into their biologically active products. This encoded protein is a calcium-dependent serine endoprotease that can efficiently cleave precursor proteins at their paired basic amino acid processing sites. Some of its substrates are: proparathyroid hormone, transforming growth factor beta 1 precursor, proalbumin, pro-beta-secretase, membrane type-1 matrix metalloproteinase, beta subunit of pro-nerve growth factor and von Willebrand factor. It is also thought to be one of the proteases responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene is thought to play a role in tumor progression. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18550) furin (paired basic amino acid cleaving enzyme)
Rat(54281) furin (paired basic amino acid cleaving enzyme)
chicken(395457) furin (paired basic amino acid cleaving enzyme)
domestic cat(101100308) furin (paired basic amino acid cleaving enzyme)
cow(281374) furin (paired basic amino acid cleaving enzyme)
Horse(100068931) furin (paired basic amino acid cleaving enzyme)
dog(488746) furin (paired basic amino acid cleaving enzyme)
sheep(780454) furin (paired basic amino acid cleaving enzyme)
domestic guinea pig(100733158) furin (paired basic amino acid cleaving enzyme)
naked mole-rat(101717888) furin (paired basic amino acid cleaving enzyme)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002569 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU018761 MISSION® esiRNA esiRNA targeting mouse Furin (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002569 siRNAs that have been validated in the lab human pricing
NM_019331 Rosetta Predictions rat pricing
NM_001081454 Rosetta Predictions mouse pricing
NM_011046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002569 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189840 validated 2566
1 SASI_Hs01_00189838 validated 1792
1 SASI_Hs01_00189839 validated 525
2 SASI_Hs01_00189842 predicted 2827
3 SASI_Hs01_00189843 predicted 1902
4 SASI_Hs01_00189844 predicted 1141
5 SASI_Hs01_00189845 predicted 1330
6 SASI_Hs01_00189846 predicted 1480
7 SASI_Hs01_00189847 predicted 2225
8 SASI_Hs02_00334063 predicted 1773
9 SASI_Hs02_00334064 predicted 1452
10 SASI_Hs01_00189841 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262309 predicted 2667
2 SASI_Rn01_00113090 predicted 2835
3 SASI_Rn01_00113091 predicted 1487
4 SASI_Rn01_00113092 predicted 1340
5 SASI_Rn01_00113093 predicted 571
6 SASI_Rn01_00113094 predicted 1649
7 SASI_Rn01_00113095 predicted 1977
8 SASI_Rn02_00262310 predicted 1373
9 SASI_Rn01_00113096 predicted 2001
10 SASI_Rn01_00113097 predicted 2309
11 SASI_Rn01_00113088 predicted 2024
12 SASI_Rn01_00113089 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298426 predicted 2429
2 SASI_Mm02_00298427 predicted 1846
3 SASI_Mm02_00298428 predicted 404
4 SASI_Mm02_00298429 predicted 1809
5 SASI_Mm02_00298430 predicted 2067
6 SASI_Mm02_00298431 predicted 1524
7 SASI_Mm02_00298432 predicted 2669
8 SASI_Mm02_00298433 predicted 1196
9 SASI_Mm02_00298434 predicted 1845
10 SASI_Mm02_00298435 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027993 predicted 2546
2 SASI_Mm01_00027994 predicted 1961
3 SASI_Mm01_00027995 predicted 522
4 SASI_Mm01_00027996 predicted 1925
5 SASI_Mm01_00027997 predicted 2190
6 SASI_Mm01_00027999 predicted 1642
7 SASI_Mm01_00028000 predicted 2782
8 SASI_Mm01_00028001 predicted 1317
9 SASI_Mm02_00319797 predicted 1969
10 SASI_Mm01_00028002 predicted 824
11 SASI_Mm01_00027998 predicted 1960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011046
VALIDATED
FURIN MISSION shRNA Bacterial Glycerol Stock
furin (paired basic amino acid cleaving enzyme)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-1506s21c1
Sequence:CCGGCCTTGGCAGCTGGTATCATTGCTCGAGCAATGATACCAGCTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-873s21c1
Sequence:CCGGCCGACCTAGCAGGCAATTATGCTCGAGCATAATTGCCTGCTAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-564s21c1
Sequence:CCGGGCCAGATCTTCGGTGACTATTCTCGAGAATAGTCACCGAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-3225s21c1
Sequence:CCGGCCGAAGAAGCTGCAGTCTTAGCTCGAGCTAAGACTGCAGCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-2078s21c1
Sequence:CCGGCTGACCAAGTTCACTCTCGTTCTCGAGAACGAGAGTGAACTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-941s1c1
Sequence:CCGGCCTCGGTACACACAGATGAATCTCGAGATTCATCTGTGTGTACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-1034s1c1
Sequence:CCGGGTAGCTTACAATGCCCGAATTCTCGAGAATTCGGGCATTGTAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-564s1c1
Sequence:CCGGGCCAGATCTTCGGTGACTATTCTCGAGAATAGTCACCGAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-2078s1c1
Sequence:CCGGCTGACCAAGTTCACTCTCGTTCTCGAGAACGAGAGTGAACTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-2551s1c1
Sequence:CCGGCTGCCTTATCATCGTGCTCATCTCGAGATGAGCACGATGATAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011046
VALIDATED
FURIN MISSION shRNA shRNA Plasmid DNA
furin (paired basic amino acid cleaving enzyme)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-1506s21c1
Sequence:CCGGCCTTGGCAGCTGGTATCATTGCTCGAGCAATGATACCAGCTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-873s21c1
Sequence:CCGGCCGACCTAGCAGGCAATTATGCTCGAGCATAATTGCCTGCTAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-564s21c1
Sequence:CCGGGCCAGATCTTCGGTGACTATTCTCGAGAATAGTCACCGAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-3225s21c1
Sequence:CCGGCCGAAGAAGCTGCAGTCTTAGCTCGAGCTAAGACTGCAGCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-2078s21c1
Sequence:CCGGCTGACCAAGTTCACTCTCGTTCTCGAGAACGAGAGTGAACTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-941s1c1
Sequence:CCGGCCTCGGTACACACAGATGAATCTCGAGATTCATCTGTGTGTACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-1034s1c1
Sequence:CCGGGTAGCTTACAATGCCCGAATTCTCGAGAATTCGGGCATTGTAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-564s1c1
Sequence:CCGGGCCAGATCTTCGGTGACTATTCTCGAGAATAGTCACCGAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-2078s1c1
Sequence:CCGGCTGACCAAGTTCACTCTCGTTCTCGAGAACGAGAGTGAACTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-2551s1c1
Sequence:CCGGCTGCCTTATCATCGTGCTCATCTCGAGATGAGCACGATGATAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011046
VALIDATED
FURIN MISSION shRNA Lentiviral Transduction Particles
furin (paired basic amino acid cleaving enzyme)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-1506s21c1
Sequence:CCGGCCTTGGCAGCTGGTATCATTGCTCGAGCAATGATACCAGCTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-873s21c1
Sequence:CCGGCCGACCTAGCAGGCAATTATGCTCGAGCATAATTGCCTGCTAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-564s21c1
Sequence:CCGGGCCAGATCTTCGGTGACTATTCTCGAGAATAGTCACCGAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-3225s21c1
Sequence:CCGGCCGAAGAAGCTGCAGTCTTAGCTCGAGCTAAGACTGCAGCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011046.2-2078s21c1
Sequence:CCGGCTGACCAAGTTCACTCTCGTTCTCGAGAACGAGAGTGAACTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-941s1c1
Sequence:CCGGCCTCGGTACACACAGATGAATCTCGAGATTCATCTGTGTGTACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-1034s1c1
Sequence:CCGGGTAGCTTACAATGCCCGAATTCTCGAGAATTCGGGCATTGTAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-564s1c1
Sequence:CCGGGCCAGATCTTCGGTGACTATTCTCGAGAATAGTCACCGAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-2078s1c1
Sequence:CCGGCTGACCAAGTTCACTCTCGTTCTCGAGAACGAGAGTGAACTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011046.1-2551s1c1
Sequence:CCGGCTGCCTTATCATCGTGCTCATCTCGAGATGAGCACGATGATAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002569
VALIDATED
FURIN MISSION shRNA Bacterial Glycerol Stock
furin (paired basic amino acid cleaving enzyme)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-514s21c1
Sequence:CCGGGTGGCAAAGCGACGGACTAAACTCGAGTTTAGTCCGTCGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002569.2-1684s21c1
Sequence:CCGGCGGCTCACCCTGTCCTATAATCTCGAGATTATAGGACAGGGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-698s21c1
Sequence:CCGGCGGACTTGGCAGGCAATTATGCTCGAGCATAATTGCCTGCCAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-3495s21c1
Sequence:CCGGCACTTTAGATGCTGATGATTTCTCGAGAAATCATCAGCATCTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-1809s21c1
Sequence:CCGGGGCCTTCATGACAACTCATTCCTCGAGGAATGAGTTGTCATGAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1852s1c1
Sequence:CCGGGAGTGGGTCCTAGAGATTGAACTCGAGTTCAATCTCTAGGACCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-2570s1c1
Sequence:CCGGCCGCCTTTATCAAAGACCAGACTCGAGTCTGGTCTTTGATAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1146s1c1
Sequence:CCGGCAGTATCTACACGCTGTCCATCTCGAGATGGACAGCGTGTAGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002569.2-2954s1c1
Sequence:CCGGCCTGTCCCTCTAAAGCAATAACTCGAGTTATTGCTTTAGAGGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1774s1c1
Sequence:CCGGCCACATGACTACTCCGCAGATCTCGAGATCTGCGGAGTAGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002569
VALIDATED
FURIN MISSION shRNA shRNA Plasmid DNA
furin (paired basic amino acid cleaving enzyme)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-514s21c1
Sequence:CCGGGTGGCAAAGCGACGGACTAAACTCGAGTTTAGTCCGTCGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002569.2-1684s21c1
Sequence:CCGGCGGCTCACCCTGTCCTATAATCTCGAGATTATAGGACAGGGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-698s21c1
Sequence:CCGGCGGACTTGGCAGGCAATTATGCTCGAGCATAATTGCCTGCCAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-3495s21c1
Sequence:CCGGCACTTTAGATGCTGATGATTTCTCGAGAAATCATCAGCATCTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-1809s21c1
Sequence:CCGGGGCCTTCATGACAACTCATTCCTCGAGGAATGAGTTGTCATGAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1852s1c1
Sequence:CCGGGAGTGGGTCCTAGAGATTGAACTCGAGTTCAATCTCTAGGACCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-2570s1c1
Sequence:CCGGCCGCCTTTATCAAAGACCAGACTCGAGTCTGGTCTTTGATAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1146s1c1
Sequence:CCGGCAGTATCTACACGCTGTCCATCTCGAGATGGACAGCGTGTAGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002569.2-2954s1c1
Sequence:CCGGCCTGTCCCTCTAAAGCAATAACTCGAGTTATTGCTTTAGAGGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1774s1c1
Sequence:CCGGCCACATGACTACTCCGCAGATCTCGAGATCTGCGGAGTAGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002569
VALIDATED
FURIN MISSION shRNA Lentiviral Transduction Particles
furin (paired basic amino acid cleaving enzyme)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-514s21c1
Sequence:CCGGGTGGCAAAGCGACGGACTAAACTCGAGTTTAGTCCGTCGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002569.2-1684s21c1
Sequence:CCGGCGGCTCACCCTGTCCTATAATCTCGAGATTATAGGACAGGGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-698s21c1
Sequence:CCGGCGGACTTGGCAGGCAATTATGCTCGAGCATAATTGCCTGCCAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-3495s21c1
Sequence:CCGGCACTTTAGATGCTGATGATTTCTCGAGAAATCATCAGCATCTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002569.2-1809s21c1
Sequence:CCGGGGCCTTCATGACAACTCATTCCTCGAGGAATGAGTTGTCATGAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1852s1c1
Sequence:CCGGGAGTGGGTCCTAGAGATTGAACTCGAGTTCAATCTCTAGGACCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-2570s1c1
Sequence:CCGGCCGCCTTTATCAAAGACCAGACTCGAGTCTGGTCTTTGATAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1146s1c1
Sequence:CCGGCAGTATCTACACGCTGTCCATCTCGAGATGGACAGCGTGTAGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002569.2-2954s1c1
Sequence:CCGGCCTGTCCCTCTAAAGCAATAACTCGAGTTATTGCTTTAGAGGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002569.2-1774s1c1
Sequence:CCGGCCACATGACTACTCCGCAGATCTCGAGATCTGCGGAGTAGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks