EMAIL THIS PAGE TO A FRIEND

FUS

fused in sarcoma

141 Gene Product Result for
Synonyms: ALS6 ETM4 FUS1 HNRNPP2 POMP75 TLS
UniProtKB ID: P35637, Q9H4A8
Gene ID:
Human(2521) Summary: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6. [provided by RefSeq, Sep 2009]
Mouse(233908) fused in sarcoma
Rat(317385) fused in sarcoma
Zebrafish(394058) fusion (involved in t(12;16) in malignant liposarcoma)
domestic cat(101088901) fused in sarcoma
cow(280796) fused in sarcoma
dog(479778) fused in sarcoma
chicken(414144) fused in sarcoma
naked mole-rat(101716667) fused in sarcoma
sheep(101104799) fused in sarcoma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108528 Anti-FUS affinity isolated antibody human, bovine, rabbit, rat, pig, canine, pig
immunohistochemistry, western blot pricing
SAB4200511 Anti-FUS (internal region) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4200455 Anti-FUS (internal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA008784 Anti-FUS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
AV40278 Anti-FUS antibody produced in rabbit affinity isolated antibody bovine, rabbit, human, mouse, rat
immunohistochemistry, western blot pricing
SAB4200454 Anti-FUS antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2700785 Anti-FUS antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
PLA0296 Goat anti-FUS Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse, pig, marmoset, rat, primate, rhesus monkey, gorilla, rabbit, chimpanzee, dog, bovine
immunoprecipitation, proximity ligation assay, western blot pricing
SAB4200478 Monoclonal Anti-FUS antibody produced in mouse clone FUS-4, tissue culture supernatant rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AMAB90549 Monoclonal Anti-FUS antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0190, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
PLA0083 Rabbit anti-FUS Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, rabbit, pig, chimpanzee, marmoset, rat, rhesus monkey, primate, gorilla, human, mouse, dog
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004960 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010850 Rosetta Predictions human pricing
NM_004960 Rosetta Predictions human pricing
NM_001012137 Rosetta Predictions rat pricing
XM_574568 Rosetta Predictions rat pricing
NM_139149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123239 predicted 279
2 SASI_Hs01_00123240 predicted 253
3 SASI_Hs01_00123241 predicted 234
4 SASI_Hs01_00123242 predicted 280
5 SASI_Hs01_00123243 predicted 248
6 SASI_Hs01_00123244 predicted 337
7 SASI_Hs01_00123245 predicted 348
8 SASI_Hs01_00123246 predicted 958
9 SASI_Hs01_00123247 predicted 100
10 SASI_Hs01_00123248 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057889 predicted 1766
2 SASI_Hs01_00057890 predicted 1767
3 SASI_Hs02_00338644 predicted 985
4 SASI_Hs01_00057891 predicted 268
5 SASI_Hs01_00057894 predicted 276
6 SASI_Hs01_00057895 predicted 1764
7 SASI_Hs02_00338645 predicted 1038
8 SASI_Hs01_00057896 predicted 236
9 SASI_Hs01_00057897 predicted 334
10 SASI_Hs01_00057898 predicted 334
11 SASI_Hs01_00057892 predicted 247
12 SASI_Hs01_00057893 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063285 predicted 593
2 SASI_Rn01_00063286 predicted 645
3 SASI_Rn01_00063287 predicted 959
4 SASI_Rn01_00063288 predicted 953
5 SASI_Rn01_00063289 predicted 1005
6 SASI_Rn01_00063290 predicted 852
7 SASI_Rn01_00063291 predicted 920
8 SASI_Rn01_00063292 predicted 1031
9 SASI_Rn01_00063293 predicted 536
10 SASI_Rn01_00063294 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172146 predicted 595
2 SASI_Rn01_00172147 predicted 635
3 SASI_Rn01_00172148 predicted 961
4 SASI_Rn01_00172149 predicted 950
5 SASI_Rn01_00172150 predicted 1000
6 SASI_Rn01_00172151 predicted 853
7 SASI_Rn01_00172152 predicted 923
8 SASI_Rn01_00172153 predicted 1028
9 SASI_Rn01_00172154 predicted 533
10 SASI_Rn01_00172155 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339898 predicted 1128
2 SASI_Mm01_00085997 predicted 976
3 SASI_Mm02_00339899 predicted 967
4 SASI_Mm01_00086000 predicted 657
5 SASI_Mm02_00339900 predicted 416
6 SASI_Mm02_00339901 predicted 867
7 SASI_Mm02_00339902 predicted 1052
8 SASI_Mm02_00339903 predicted 914
9 SASI_Mm02_00339904 predicted 1052
10 SASI_Mm02_00339905 predicted 978
11 SASI_Mm01_00085991 predicted 444
12 SASI_Mm01_00085992 predicted 426
13 SASI_Mm01_00085993 predicted 357
14 SASI_Mm01_00085994 predicted 230
15 SASI_Mm01_00085995 predicted 842
16 SASI_Mm01_00085996 predicted 533
17 SASI_Mm01_00085998 predicted 890
18 SASI_Mm01_00085999 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004960
VALIDATED
FUS MISSION shRNA Bacterial Glycerol Stock
fused in sarcoma
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1638s1c1
Sequence:CCGGTCGCAGGGAGAGGCCGTATTACTCGAGTAATACGGCCTCTCCCTGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1403s1c1
Sequence:CCGGATGAATGCAACCAGTGTAAGGCTCGAGCCTTACACTGGTTGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1768s1c1
Sequence:CCGGCGGACTATGTAATTGTAACTACTCGAGTAGTTACAATTACATAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004960.x-912s1c1
Sequence:CCGGACAGGATAATTCAGACAACAACTCGAGTTGTTGTCTGAATTATCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-853s1c1
Sequence:CCGGCGTGGTGGCTTCAATAAATTTCTCGAGAAATTTATTGAAGCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-950s1c1
Sequence:CCGGGCCTGGGTGAGAATGTTACAACTCGAGTTGTAACATTCTCACCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039823    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-1735s1c1
Sequence:CCGGTTCCTGATCACCCAAGGGTTCCTCGAGGAACCCTTGGGTGATCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-982s1c1
Sequence:CCGGGCTGATTACTTCAAGCAGATTCTCGAGAATCTGCTTGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-951s1c1
Sequence:CCGGCCTGGGTGAGAATGTTACAATCTCGAGATTGTAACATTCTCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-909s1c1
Sequence:CCGGCGAACAGGATAATTCAGACAACTCGAGTTGTCTGAATTATCCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-231s1c1
Sequence:CCGGCCAGAGCAGCTATTCTTCTTACTCGAGTAAGAAGAATAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-987s21c1
Sequence:CCGGGCTGATTACTTCAAGCAGATTCTCGAGAATCTGCTTGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-236s21c1
Sequence:CCGGCCAGAGCAGCTATTCTTCTTACTCGAGTAAGAAGAATAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-858s21c1
Sequence:CCGGCGTGGTGGCTTCAATAAATTTCTCGAGAAATTTATTGAAGCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-1408s21c1
Sequence:CCGGATGAATGCAACCAGTGTAAGGCTCGAGCCTTACACTGGTTGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004960
VALIDATED
FUS MISSION shRNA shRNA Plasmid DNA
fused in sarcoma
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1638s1c1
Sequence:CCGGTCGCAGGGAGAGGCCGTATTACTCGAGTAATACGGCCTCTCCCTGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1403s1c1
Sequence:CCGGATGAATGCAACCAGTGTAAGGCTCGAGCCTTACACTGGTTGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1768s1c1
Sequence:CCGGCGGACTATGTAATTGTAACTACTCGAGTAGTTACAATTACATAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004960.x-912s1c1
Sequence:CCGGACAGGATAATTCAGACAACAACTCGAGTTGTTGTCTGAATTATCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-853s1c1
Sequence:CCGGCGTGGTGGCTTCAATAAATTTCTCGAGAAATTTATTGAAGCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-950s1c1
Sequence:CCGGGCCTGGGTGAGAATGTTACAACTCGAGTTGTAACATTCTCACCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039823    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-1735s1c1
Sequence:CCGGTTCCTGATCACCCAAGGGTTCCTCGAGGAACCCTTGGGTGATCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-982s1c1
Sequence:CCGGGCTGATTACTTCAAGCAGATTCTCGAGAATCTGCTTGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-951s1c1
Sequence:CCGGCCTGGGTGAGAATGTTACAATCTCGAGATTGTAACATTCTCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-909s1c1
Sequence:CCGGCGAACAGGATAATTCAGACAACTCGAGTTGTCTGAATTATCCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-231s1c1
Sequence:CCGGCCAGAGCAGCTATTCTTCTTACTCGAGTAAGAAGAATAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-987s21c1
Sequence:CCGGGCTGATTACTTCAAGCAGATTCTCGAGAATCTGCTTGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-236s21c1
Sequence:CCGGCCAGAGCAGCTATTCTTCTTACTCGAGTAAGAAGAATAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-858s21c1
Sequence:CCGGCGTGGTGGCTTCAATAAATTTCTCGAGAAATTTATTGAAGCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-1408s21c1
Sequence:CCGGATGAATGCAACCAGTGTAAGGCTCGAGCCTTACACTGGTTGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004960
VALIDATED
FUS MISSION shRNA Lentiviral Transduction Particles
fused in sarcoma
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1638s1c1
Sequence:CCGGTCGCAGGGAGAGGCCGTATTACTCGAGTAATACGGCCTCTCCCTGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1403s1c1
Sequence:CCGGATGAATGCAACCAGTGTAAGGCTCGAGCCTTACACTGGTTGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-1768s1c1
Sequence:CCGGCGGACTATGTAATTGTAACTACTCGAGTAGTTACAATTACATAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004960.x-912s1c1
Sequence:CCGGACAGGATAATTCAGACAACAACTCGAGTTGTTGTCTGAATTATCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-853s1c1
Sequence:CCGGCGTGGTGGCTTCAATAAATTTCTCGAGAAATTTATTGAAGCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.x-950s1c1
Sequence:CCGGGCCTGGGTGAGAATGTTACAACTCGAGTTGTAACATTCTCACCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039823    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-1735s1c1
Sequence:CCGGTTCCTGATCACCCAAGGGTTCCTCGAGGAACCCTTGGGTGATCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-982s1c1
Sequence:CCGGGCTGATTACTTCAAGCAGATTCTCGAGAATCTGCTTGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-951s1c1
Sequence:CCGGCCTGGGTGAGAATGTTACAATCTCGAGATTGTAACATTCTCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-909s1c1
Sequence:CCGGCGAACAGGATAATTCAGACAACTCGAGTTGTCTGAATTATCCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004960.1-231s1c1
Sequence:CCGGCCAGAGCAGCTATTCTTCTTACTCGAGTAAGAAGAATAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-987s21c1
Sequence:CCGGGCTGATTACTTCAAGCAGATTCTCGAGAATCTGCTTGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-236s21c1
Sequence:CCGGCCAGAGCAGCTATTCTTCTTACTCGAGTAAGAAGAATAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-858s21c1
Sequence:CCGGCGTGGTGGCTTCAATAAATTTCTCGAGAAATTTATTGAAGCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004960.2-1408s21c1
Sequence:CCGGATGAATGCAACCAGTGTAAGGCTCGAGCCTTACACTGGTTGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139149
VALIDATED
FUS MISSION shRNA Bacterial Glycerol Stock
fused in sarcoma
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139149.1-1602s1c1
Sequence:CCGGCCCAGTGTTACCCTTGTTATTCTCGAGAATAACAAGGGTAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-868s1c1
Sequence:CCGGGCGAGAATGTTACAATTGAATCTCGAGATTCAATTGTAACATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-863s1c1
Sequence:CCGGCCTAGGCGAGAATGTTACAATCTCGAGATTGTAACATTCTCGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-114s1c1
Sequence:CCGGCAACAGAGTTACAGTGGTTATCTCGAGATAACCACTGTAACTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-113s1c1
Sequence:CCGGCCAACAGAGTTACAGTGGTTACTCGAGTAACCACTGTAACTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-243s21c1
Sequence:CCGGAGCAGCTATGGTTCTTCTTATCTCGAGATAAGAAGAACCATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-939s21c1
Sequence:GTACCGGCTAGGCGAGAATGTTACAATTCTCGAGAATTGTAACATTCTCGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-1677s21c1
Sequence:CCGGCCCAGTGTTACCCTTGTTATTCTCGAGAATAACAAGGGTAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1622s21c1
Sequence:CCGGTCGCAGGGAGAGGCCATATTACTCGAGTAATATGGCCTCTCCCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-875s21c1
Sequence:CCGGTCAAGGATCTCGTCATGATTCCTCGAGGAATCATGACGAGATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-522s21c1
Sequence:CCGGCAACAACAAAGCTCCTATAACCTCGAGGTTATAGGAGCTTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1117s21c1
Sequence:CCGGTCGACTGGTTTGATGGTAAAGCTCGAGCTTTACCATCAAACCAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1145s21c1
Sequence:CCGGTGGGAATCCTATTAAAGTTTCCTCGAGGAAACTTTAATAGGATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139149
VALIDATED
FUS MISSION shRNA shRNA Plasmid DNA
fused in sarcoma
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139149.1-1602s1c1
Sequence:CCGGCCCAGTGTTACCCTTGTTATTCTCGAGAATAACAAGGGTAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-868s1c1
Sequence:CCGGGCGAGAATGTTACAATTGAATCTCGAGATTCAATTGTAACATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-863s1c1
Sequence:CCGGCCTAGGCGAGAATGTTACAATCTCGAGATTGTAACATTCTCGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-114s1c1
Sequence:CCGGCAACAGAGTTACAGTGGTTATCTCGAGATAACCACTGTAACTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-113s1c1
Sequence:CCGGCCAACAGAGTTACAGTGGTTACTCGAGTAACCACTGTAACTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-243s21c1
Sequence:CCGGAGCAGCTATGGTTCTTCTTATCTCGAGATAAGAAGAACCATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-939s21c1
Sequence:GTACCGGCTAGGCGAGAATGTTACAATTCTCGAGAATTGTAACATTCTCGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-1677s21c1
Sequence:CCGGCCCAGTGTTACCCTTGTTATTCTCGAGAATAACAAGGGTAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1622s21c1
Sequence:CCGGTCGCAGGGAGAGGCCATATTACTCGAGTAATATGGCCTCTCCCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-875s21c1
Sequence:CCGGTCAAGGATCTCGTCATGATTCCTCGAGGAATCATGACGAGATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-522s21c1
Sequence:CCGGCAACAACAAAGCTCCTATAACCTCGAGGTTATAGGAGCTTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1117s21c1
Sequence:CCGGTCGACTGGTTTGATGGTAAAGCTCGAGCTTTACCATCAAACCAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1145s21c1
Sequence:CCGGTGGGAATCCTATTAAAGTTTCCTCGAGGAAACTTTAATAGGATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139149
VALIDATED
FUS MISSION shRNA Lentiviral Transduction Particles
fused in sarcoma
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139149.1-1602s1c1
Sequence:CCGGCCCAGTGTTACCCTTGTTATTCTCGAGAATAACAAGGGTAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-868s1c1
Sequence:CCGGGCGAGAATGTTACAATTGAATCTCGAGATTCAATTGTAACATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-863s1c1
Sequence:CCGGCCTAGGCGAGAATGTTACAATCTCGAGATTGTAACATTCTCGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-114s1c1
Sequence:CCGGCAACAGAGTTACAGTGGTTATCTCGAGATAACCACTGTAACTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139149.1-113s1c1
Sequence:CCGGCCAACAGAGTTACAGTGGTTACTCGAGTAACCACTGTAACTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-243s21c1
Sequence:CCGGAGCAGCTATGGTTCTTCTTATCTCGAGATAAGAAGAACCATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-939s21c1
Sequence:GTACCGGCTAGGCGAGAATGTTACAATTCTCGAGAATTGTAACATTCTCGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-1677s21c1
Sequence:CCGGCCCAGTGTTACCCTTGTTATTCTCGAGAATAACAAGGGTAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1622s21c1
Sequence:CCGGTCGCAGGGAGAGGCCATATTACTCGAGTAATATGGCCTCTCCCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-875s21c1
Sequence:CCGGTCAAGGATCTCGTCATGATTCCTCGAGGAATCATGACGAGATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139149.2-522s21c1
Sequence:CCGGCAACAACAAAGCTCCTATAACCTCGAGGTTATAGGAGCTTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1117s21c1
Sequence:CCGGTCGACTGGTTTGATGGTAAAGCTCGAGCTTTACCATCAAACCAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139149.2-1145s21c1
Sequence:CCGGTGGGAATCCTATTAAAGTTTCCTCGAGGAAACTTTAATAGGATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks