EMAIL THIS PAGE TO A FRIEND

FUT10

fucosyltransferase 10 (alpha (1,3) fucosyltransferase)

68 Gene Product Result for
Gene ID:
Mouse(171167) fucosyltransferase 10
Rat(497619) fucosyltransferase 10
naked mole-rat(101721284) fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
domestic guinea pig(100721726) fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
sheep(101107844) fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Zebrafish(497615) fucosyltransferase 10
Thale Cress(816027) fucosyltransferase 10
chicken(395073) fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
dog(503548) fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
cow(360195) fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
domestic cat(101097389) fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032664 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032664 Rosetta Predictions human pricing
NM_001012360 Rosetta Predictions rat pricing
NM_001012517 Rosetta Predictions mouse pricing
NM_134161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052498 predicted 901
2 SASI_Hs01_00052499 predicted 378
3 SASI_Hs02_00360212 predicted 942
4 SASI_Hs01_00052500 predicted 737
5 SASI_Hs01_00052501 predicted 1777
6 SASI_Hs01_00052502 predicted 1128
7 SASI_Hs01_00052503 predicted 1377
8 SASI_Hs01_00052504 predicted 1719
9 SASI_Hs01_00052505 predicted 770
10 SASI_Hs01_00052506 predicted 1355
11 SASI_Hs01_00052507 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200551 predicted 701
2 SASI_Rn01_00094380 predicted 305
3 SASI_Rn01_00094381 predicted 590
4 SASI_Rn01_00094382 predicted 569
5 SASI_Rn01_00094383 predicted 378
6 SASI_Rn01_00094384 predicted 839
7 SASI_Rn01_00094385 predicted 414
8 SASI_Rn01_00094386 predicted 550
9 SASI_Rn01_00094388 predicted 773
10 SASI_Rn01_00094389 predicted 1041
11 SASI_Rn01_00094387 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167246 predicted 1297
2 SASI_Mm01_00167247 predicted 926
3 SASI_Mm02_00287120 predicted 823
4 SASI_Mm01_00167248 predicted 718
5 SASI_Mm01_00167249 predicted 940
6 SASI_Mm01_00167250 predicted 1137
7 SASI_Mm01_00167251 predicted 693
8 SASI_Mm01_00167252 predicted 915
9 SASI_Mm01_00167253 predicted 1171
10 SASI_Mm01_00167254 predicted 1283
11 SASI_Mm01_00167255 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145920 predicted 1341
2 SASI_Mm01_00145921 predicted 975
3 SASI_Mm02_00339426 predicted 866
4 SASI_Mm01_00145922 predicted 767
5 SASI_Mm01_00145923 predicted 990
6 SASI_Mm01_00145924 predicted 1185
7 SASI_Mm01_00145925 predicted 743
8 SASI_Mm01_00145926 predicted 970
9 SASI_Mm01_00145927 predicted 1215
10 SASI_Mm01_00145928 predicted 1331
11 SASI_Mm01_00145929 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032664
VALIDATED
FUT10 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-522s1c1
Sequence:CCGGCCTACGCATCTTAATTCATTTCTCGAGAAATGAATTAAGATGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032664.3-1170s1c1
Sequence:CCGGGCACAGTATAAGTTTATCCTACTCGAGTAGGATAAACTTATACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-827s1c1
Sequence:CCGGGCTCTTTCATAAACCAGTGATCTCGAGATCACTGGTTTATGAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-3162s1c1
Sequence:CCGGCCCAGCTCTTTCATTAACTAACTCGAGTTAGTTAATGAAAGAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-893s1c1
Sequence:CCGGGCCACTAACTACCCAATACTTCTCGAGAAGTATTGGGTAGTTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-927s21c1
Sequence:CCGGGTCCTGAAGTCACTCCGATACCTCGAGGTATCGGAGTGACTTCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-730s21c1
Sequence:CCGGATGGTACTGACTTTAACATAGCTCGAGCTATGTTAAAGTCAGTACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1724s21c1
Sequence:CCGGACTAAGGTGGCTGGTTGATAGCTCGAGCTATCAACCAGCCACCTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1085s21c1
Sequence:CCGGTGGTGAATGTTTACGAAACAACTCGAGTTGTTTCGTAAACATTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-2079s21c1
Sequence:CCGGTCACCTAGAGTGAGTACTTTCCTCGAGGAAAGTACTCACTCTAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1389s21c1
Sequence:CCGGAGATTGTATGAGGCCTATGTACTCGAGTACATAGGCCTCATACAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-2154s21c1
Sequence:CCGGCTCAACAGCTTATTGGTATTTCTCGAGAAATACCAATAAGCTGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1497s21c1
Sequence:CCGGGACAATTACATCGATGCATTTCTCGAGAAATGCATCGATGTAATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1532s21c1
Sequence:CCGGCACCAAGGTGTGGGCTAATATCTCGAGATATTAGCCCACACCTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-1827s21c1
Sequence:CCGGGAGCCTTCTTGAGGTTTATTTCTCGAGAAATAAACCTCAAGAAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-654s21c1
Sequence:CCGGTGTGGAGCAGATGCTTGTTTCCTCGAGGAAACAAGCATCTGCTCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1661s21c1
Sequence:CCGGTTTGAGCTCTTTGCGAGAGATCTCGAGATCTCTCGCAAAGAGCTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032664
VALIDATED
FUT10 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-522s1c1
Sequence:CCGGCCTACGCATCTTAATTCATTTCTCGAGAAATGAATTAAGATGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032664.3-1170s1c1
Sequence:CCGGGCACAGTATAAGTTTATCCTACTCGAGTAGGATAAACTTATACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-827s1c1
Sequence:CCGGGCTCTTTCATAAACCAGTGATCTCGAGATCACTGGTTTATGAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-3162s1c1
Sequence:CCGGCCCAGCTCTTTCATTAACTAACTCGAGTTAGTTAATGAAAGAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-893s1c1
Sequence:CCGGGCCACTAACTACCCAATACTTCTCGAGAAGTATTGGGTAGTTAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-927s21c1
Sequence:CCGGGTCCTGAAGTCACTCCGATACCTCGAGGTATCGGAGTGACTTCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-730s21c1
Sequence:CCGGATGGTACTGACTTTAACATAGCTCGAGCTATGTTAAAGTCAGTACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1724s21c1
Sequence:CCGGACTAAGGTGGCTGGTTGATAGCTCGAGCTATCAACCAGCCACCTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1085s21c1
Sequence:CCGGTGGTGAATGTTTACGAAACAACTCGAGTTGTTTCGTAAACATTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-2079s21c1
Sequence:CCGGTCACCTAGAGTGAGTACTTTCCTCGAGGAAAGTACTCACTCTAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1389s21c1
Sequence:CCGGAGATTGTATGAGGCCTATGTACTCGAGTACATAGGCCTCATACAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-2154s21c1
Sequence:CCGGCTCAACAGCTTATTGGTATTTCTCGAGAAATACCAATAAGCTGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1497s21c1
Sequence:CCGGGACAATTACATCGATGCATTTCTCGAGAAATGCATCGATGTAATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1532s21c1
Sequence:CCGGCACCAAGGTGTGGGCTAATATCTCGAGATATTAGCCCACACCTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-1827s21c1
Sequence:CCGGGAGCCTTCTTGAGGTTTATTTCTCGAGAAATAAACCTCAAGAAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-654s21c1
Sequence:CCGGTGTGGAGCAGATGCTTGTTTCCTCGAGGAAACAAGCATCTGCTCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1661s21c1
Sequence:CCGGTTTGAGCTCTTTGCGAGAGATCTCGAGATCTCTCGCAAAGAGCTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032664
VALIDATED
FUT10 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-522s1c1
Sequence:CCGGCCTACGCATCTTAATTCATTTCTCGAGAAATGAATTAAGATGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032664.3-1170s1c1
Sequence:CCGGGCACAGTATAAGTTTATCCTACTCGAGTAGGATAAACTTATACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-827s1c1
Sequence:CCGGGCTCTTTCATAAACCAGTGATCTCGAGATCACTGGTTTATGAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-3162s1c1
Sequence:CCGGCCCAGCTCTTTCATTAACTAACTCGAGTTAGTTAATGAAAGAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032664.3-893s1c1
Sequence:CCGGGCCACTAACTACCCAATACTTCTCGAGAAGTATTGGGTAGTTAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-927s21c1
Sequence:CCGGGTCCTGAAGTCACTCCGATACCTCGAGGTATCGGAGTGACTTCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-730s21c1
Sequence:CCGGATGGTACTGACTTTAACATAGCTCGAGCTATGTTAAAGTCAGTACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1724s21c1
Sequence:CCGGACTAAGGTGGCTGGTTGATAGCTCGAGCTATCAACCAGCCACCTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1085s21c1
Sequence:CCGGTGGTGAATGTTTACGAAACAACTCGAGTTGTTTCGTAAACATTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-2079s21c1
Sequence:CCGGTCACCTAGAGTGAGTACTTTCCTCGAGGAAAGTACTCACTCTAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1389s21c1
Sequence:CCGGAGATTGTATGAGGCCTATGTACTCGAGTACATAGGCCTCATACAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-2154s21c1
Sequence:CCGGCTCAACAGCTTATTGGTATTTCTCGAGAAATACCAATAAGCTGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1497s21c1
Sequence:CCGGGACAATTACATCGATGCATTTCTCGAGAAATGCATCGATGTAATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1532s21c1
Sequence:CCGGCACCAAGGTGTGGGCTAATATCTCGAGATATTAGCCCACACCTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032664.3-1827s21c1
Sequence:CCGGGAGCCTTCTTGAGGTTTATTTCTCGAGAAATAAACCTCAAGAAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-654s21c1
Sequence:CCGGTGTGGAGCAGATGCTTGTTTCCTCGAGGAAACAAGCATCTGCTCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032664.3-1661s21c1
Sequence:CCGGTTTGAGCTCTTTGCGAGAGATCTCGAGATCTCTCGCAAAGAGCTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012517
VALIDATED
FUT10 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-607s1c1
Sequence:CCGGGCTAAGAACAACCTAAGACAACTCGAGTTGTCTTAGGTTGTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-1029s1c1
Sequence:CCGGCGATGGGTTGTATGAGACCTACTCGAGTAGGTCTCATACAACCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-487s1c1
Sequence:CCGGGTCATCACCTTATTCAACCATCTCGAGATGGTTGAATAAGGTGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-382s1c1
Sequence:CCGGGACTTTAACATAGACAGCTTACTCGAGTAAGCTGTCTATGTTAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-1141s1c1
Sequence:CCGGGACAACTACATTGACTCGTTTCTCGAGAAACGAGTCAATGTAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-1061s21c1
Sequence:CCGGGATTCCTATGGCGAGTGTTTACTCGAGTAAACACTCGCCATAGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-827s21c1
Sequence:CCGGGTCATCACCTTATTCAACCATCTCGAGATGGTTGAATAAGGTGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-1144s21c1
Sequence:CCGGCAGAGTCATTGCCCAGTATAACTCGAGTTATACTGGGCAATGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012517.4-2160s21c1
Sequence:CCGGTTGAATGAATGAACCGCATTACTCGAGTAATGCGGTTCATTCATTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-947s21c1
Sequence:CCGGGCTAAGAACAACCTAAGACAACTCGAGTTGTCTTAGGTTGTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012517.4-1369s21c1
Sequence:CCGGCGATGGGTTGTATGAGACCTACTCGAGTAGGTCTCATACAACCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012517
VALIDATED
FUT10 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-607s1c1
Sequence:CCGGGCTAAGAACAACCTAAGACAACTCGAGTTGTCTTAGGTTGTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-1029s1c1
Sequence:CCGGCGATGGGTTGTATGAGACCTACTCGAGTAGGTCTCATACAACCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-487s1c1
Sequence:CCGGGTCATCACCTTATTCAACCATCTCGAGATGGTTGAATAAGGTGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-382s1c1
Sequence:CCGGGACTTTAACATAGACAGCTTACTCGAGTAAGCTGTCTATGTTAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-1141s1c1
Sequence:CCGGGACAACTACATTGACTCGTTTCTCGAGAAACGAGTCAATGTAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-1061s21c1
Sequence:CCGGGATTCCTATGGCGAGTGTTTACTCGAGTAAACACTCGCCATAGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-827s21c1
Sequence:CCGGGTCATCACCTTATTCAACCATCTCGAGATGGTTGAATAAGGTGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-1144s21c1
Sequence:CCGGCAGAGTCATTGCCCAGTATAACTCGAGTTATACTGGGCAATGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012517.4-2160s21c1
Sequence:CCGGTTGAATGAATGAACCGCATTACTCGAGTAATGCGGTTCATTCATTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-947s21c1
Sequence:CCGGGCTAAGAACAACCTAAGACAACTCGAGTTGTCTTAGGTTGTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012517.4-1369s21c1
Sequence:CCGGCGATGGGTTGTATGAGACCTACTCGAGTAGGTCTCATACAACCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012517
VALIDATED
FUT10 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 10 (alpha (1,3) fucosyltransferase)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-607s1c1
Sequence:CCGGGCTAAGAACAACCTAAGACAACTCGAGTTGTCTTAGGTTGTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-1029s1c1
Sequence:CCGGCGATGGGTTGTATGAGACCTACTCGAGTAGGTCTCATACAACCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-487s1c1
Sequence:CCGGGTCATCACCTTATTCAACCATCTCGAGATGGTTGAATAAGGTGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-382s1c1
Sequence:CCGGGACTTTAACATAGACAGCTTACTCGAGTAAGCTGTCTATGTTAAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001012517.1-1141s1c1
Sequence:CCGGGACAACTACATTGACTCGTTTCTCGAGAAACGAGTCAATGTAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-1061s21c1
Sequence:CCGGGATTCCTATGGCGAGTGTTTACTCGAGTAAACACTCGCCATAGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-827s21c1
Sequence:CCGGGTCATCACCTTATTCAACCATCTCGAGATGGTTGAATAAGGTGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-1144s21c1
Sequence:CCGGCAGAGTCATTGCCCAGTATAACTCGAGTTATACTGGGCAATGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012517.4-2160s21c1
Sequence:CCGGTTGAATGAATGAACCGCATTACTCGAGTAATGCGGTTCATTCATTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001012517.4-947s21c1
Sequence:CCGGGCTAAGAACAACCTAAGACAACTCGAGTTGTCTTAGGTTGTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012517.4-1369s21c1
Sequence:CCGGCGATGGGTTGTATGAGACCTACTCGAGTAGGTCTCATACAACCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)