EMAIL THIS PAGE TO A FRIEND

FUT1

fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)

91 Gene Product Result for
Synonyms: H HH HSC
UniProtKB ID: P19526, O14505, O14506, O14507
Gene ID:
Human(2523) Summary: The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the soluble A and B antigen synthesis pathway. This gene is one of two encoding the galactoside 2-L-fucosyltransferase enzyme. Mutations in this gene are a cause of the H-Bombay blood group. [provided by RefSeq, Jul 2008]
Mouse(14343) fucosyltransferase 1
Rat(81919) fucosyltransferase 1
dog(484396) fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
domestic cat(101080847) fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
cow(281174) fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Goat(100860824) fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
sheep(101108248) fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
domestic guinea pig(100728677) fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
naked mole-rat(101709834) fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000148 Rosetta Predictions human pricing
NM_031236 Rosetta Predictions rat pricing
NM_008051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196276 predicted 1934
2 SASI_Hs01_00196277 predicted 2236
3 SASI_Hs01_00196278 predicted 2020
4 SASI_Hs01_00196279 predicted 2227
5 SASI_Hs01_00196280 predicted 2190
6 SASI_Hs01_00196281 predicted 2089
7 SASI_Hs01_00196282 predicted 1444
8 SASI_Hs01_00196284 predicted 2053
9 SASI_Hs01_00196285 predicted 1243
10 SASI_Hs02_00301964 predicted 1945
11 SASI_Hs01_00196283 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095197 predicted 644
2 SASI_Rn01_00095198 predicted 1447
3 SASI_Rn01_00095199 predicted 1475
4 SASI_Rn01_00095201 predicted 1611
5 SASI_Rn02_00264511 predicted 1027
6 SASI_Rn01_00095204 predicted 756
7 SASI_Rn01_00095205 predicted 1486
8 SASI_Rn02_00264512 predicted 1399
9 SASI_Rn01_00095206 predicted 910
10 SASI_Rn02_00264513 predicted 904
11 SASI_Rn01_00095200 predicted 1120
12 SASI_Rn01_00095202 predicted 1533
13 SASI_Rn01_00095203 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196439 predicted 736
2 SASI_Mm01_00196440 predicted 1024
3 SASI_Mm01_00196441 predicted 810
4 SASI_Mm01_00196442 predicted 224
5 SASI_Mm01_00196443 predicted 776
6 SASI_Mm02_00313021 predicted 247
7 SASI_Mm02_00313022 predicted 1135
8 SASI_Mm01_00196445 predicted 680
9 SASI_Mm01_00196446 predicted 1355
10 SASI_Mm01_00196447 predicted 1066
11 SASI_Mm01_00196444 predicted 1299
12 SASI_Mm01_00196448 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008051
FUT1 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-398s1c1
Sequence:CCGGAGGCAGGTTTGGTAACCAGATCTCGAGATCTGGTTACCAAACCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-684s1c1
Sequence:CCGGCGTAGGGAATTCACTCTGCATCTCGAGATGCAGAGTGAATTCCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-948s1c1
Sequence:CCGGGAGAACATTGACACATCCCATCTCGAGATGGGATGTGTCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-803s1c1
Sequence:CCGGTGGAGACTATCTGGAGGTGATCTCGAGATCACCTCCAGATAGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-313s1c1
Sequence:CCGGCTCATCCATTGCAGACATCTACTCGAGTAGATGTCTGCAATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008051
FUT1 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-398s1c1
Sequence:CCGGAGGCAGGTTTGGTAACCAGATCTCGAGATCTGGTTACCAAACCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-684s1c1
Sequence:CCGGCGTAGGGAATTCACTCTGCATCTCGAGATGCAGAGTGAATTCCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-948s1c1
Sequence:CCGGGAGAACATTGACACATCCCATCTCGAGATGGGATGTGTCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-803s1c1
Sequence:CCGGTGGAGACTATCTGGAGGTGATCTCGAGATCACCTCCAGATAGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-313s1c1
Sequence:CCGGCTCATCCATTGCAGACATCTACTCGAGTAGATGTCTGCAATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008051
FUT1 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-398s1c1
Sequence:CCGGAGGCAGGTTTGGTAACCAGATCTCGAGATCTGGTTACCAAACCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-684s1c1
Sequence:CCGGCGTAGGGAATTCACTCTGCATCTCGAGATGCAGAGTGAATTCCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-948s1c1
Sequence:CCGGGAGAACATTGACACATCCCATCTCGAGATGGGATGTGTCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-803s1c1
Sequence:CCGGTGGAGACTATCTGGAGGTGATCTCGAGATCACCTCCAGATAGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008051.2-313s1c1
Sequence:CCGGCTCATCCATTGCAGACATCTACTCGAGTAGATGTCTGCAATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000148
FUT1 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-544s1c1
Sequence:CCGGCGACTGGATGTCGGAGGAGTACTCGAGTACTCCTCCGACATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-565s1c1
Sequence:CCGGCGCGGACTTGAGAGATCCTTTCTCGAGAAAGGATCTCTCAAGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-361s1c1
Sequence:CCGGTGGCCGGTTTGGTAATCAGATCTCGAGATCTGATTACCAAACCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-1174s1c1
Sequence:CCGGTCCACTCTGGACATTGGCTAACTCGAGTTAGCCAATGTCCAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-179s1c1
Sequence:CCGGCATATCCATCAAGACAGCTTTCTCGAGAAAGCTGTCTTGATGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000148
FUT1 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-544s1c1
Sequence:CCGGCGACTGGATGTCGGAGGAGTACTCGAGTACTCCTCCGACATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-565s1c1
Sequence:CCGGCGCGGACTTGAGAGATCCTTTCTCGAGAAAGGATCTCTCAAGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-361s1c1
Sequence:CCGGTGGCCGGTTTGGTAATCAGATCTCGAGATCTGATTACCAAACCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-1174s1c1
Sequence:CCGGTCCACTCTGGACATTGGCTAACTCGAGTTAGCCAATGTCCAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-179s1c1
Sequence:CCGGCATATCCATCAAGACAGCTTTCTCGAGAAAGCTGTCTTGATGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000148
FUT1 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-544s1c1
Sequence:CCGGCGACTGGATGTCGGAGGAGTACTCGAGTACTCCTCCGACATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-565s1c1
Sequence:CCGGCGCGGACTTGAGAGATCCTTTCTCGAGAAAGGATCTCTCAAGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-361s1c1
Sequence:CCGGTGGCCGGTTTGGTAATCAGATCTCGAGATCTGATTACCAAACCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-1174s1c1
Sequence:CCGGTCCACTCTGGACATTGGCTAACTCGAGTTAGCCAATGTCCAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000148.1-179s1c1
Sequence:CCGGCATATCCATCAAGACAGCTTTCTCGAGAAAGCTGTCTTGATGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks