EMAIL THIS PAGE TO A FRIEND

FUT2

fucosyltransferase 2 (secretor status included)

79 Gene Product Result for
Synonyms: B12QTL1 SE SEC2 Se2 sej
UniProtKB ID: Q10981, Q0VAG5, Q14338, Q5D0G2
Gene ID:
Human(2524) Summary: The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the soluble A and B antigen synthesis pathway. This gene is one of two encoding the galactoside 2-L-fucosyltransferase enzyme. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14344) fucosyltransferase 2
Rat(58924) fucosyltransferase 2 (secretor status included)
Thale Cress(814850) fucosyltransferase 2
domestic cat(101085847) fucosyltransferase 2 (secretor status included)
cow(281175) fucosyltransferase 2 (secretor status included)
dog(484398) fucosyltransferase 2 (secretor status included)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075251 MISSION® esiRNA esiRNA human FUT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000511 Rosetta Predictions human pricing
NM_001097638 Rosetta Predictions human pricing
NM_031635 Rosetta Predictions rat pricing
NM_018876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129707 predicted 944
2 SASI_Hs01_00129708 predicted 730
3 SASI_Hs01_00129710 predicted 827
4 SASI_Hs02_00302696 predicted 845
5 SASI_Hs02_00302697 predicted 894
6 SASI_Hs01_00129712 predicted 799
7 SASI_Hs01_00129715 predicted 813
8 SASI_Hs02_00302698 predicted 962
9 SASI_Hs02_00302699 predicted 893
10 SASI_Hs02_00302700 predicted 999
11 SASI_Hs01_00129706 predicted 346
12 SASI_Hs01_00129709 predicted 247
13 SASI_Hs01_00129711 predicted 333
14 SASI_Hs01_00129713 predicted 253
15 SASI_Hs01_00129714 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318530 predicted 928
2 SASI_Hs02_00318531 predicted 715
3 SASI_Hs02_00318532 predicted 817
4 SASI_Hs02_00318533 predicted 835
5 SASI_Hs02_00318534 predicted 886
6 SASI_Hs02_00318535 predicted 784
7 SASI_Hs02_00318536 predicted 798
8 SASI_Hs02_00318537 predicted 952
9 SASI_Hs02_00318538 predicted 887
10 SASI_Hs02_00318539 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033799 predicted 1019
2 SASI_Rn02_00264941 predicted 250
3 SASI_Rn01_00033800 predicted 466
4 SASI_Rn02_00264942 predicted 1020
5 SASI_Rn02_00264943 predicted 1144
6 SASI_Rn01_00033805 predicted 1317
7 SASI_Rn01_00033806 predicted 1157
8 SASI_Rn02_00264944 predicted 472
9 SASI_Rn02_00264945 predicted 1079
10 SASI_Rn01_00033808 predicted 1103
11 SASI_Rn01_00033801 predicted 635
12 SASI_Rn01_00033802 predicted 684
13 SASI_Rn01_00033803 predicted 959
14 SASI_Rn01_00033804 predicted 568
15 SASI_Rn01_00033807 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038132 predicted 1300
2 SASI_Mm01_00038133 predicted 352
3 SASI_Mm02_00324272 predicted 1306
4 SASI_Mm01_00038134 predicted 1299
5 SASI_Mm01_00038136 predicted 898
6 SASI_Mm01_00038137 predicted 348
7 SASI_Mm01_00038139 predicted 1317
8 SASI_Mm01_00038140 predicted 1023
9 SASI_Mm01_00038141 predicted 1286
10 SASI_Mm02_00324273 predicted 1356
11 SASI_Mm01_00038135 predicted 552
12 SASI_Mm01_00038138 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000511
FUT2 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 2 (secretor status included)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-195s1c1
Sequence:CCGGCCTGTTCACTATCAACTCCAACTCGAGTTGGAGTTGATAGTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-834s1c1
Sequence:CCGGTGCTCTACTCACACAGTGTAACTCGAGTTACACTGTGTGAGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-621s1c1
Sequence:CCGGCTATGTCCATGTCATGCCAAACTCGAGTTTGGCATGACATGGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-58s1c1
Sequence:CCGGTCCACCTTCTACTTCGTCTTTCTCGAGAAAGACGAAGTAGAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-1136s21c1
Sequence:CCGGCCCTTACTCAAGCACTAATGCCTCGAGGCATTAGTGCTTGAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-260s21c1
Sequence:CCGGGTGCTAGCCTCAACATCAAAGCTCGAGCTTTGATGTTGAGGCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-179s21c1
Sequence:CCGGTTTACGGTTTCCACTATATTTCTCGAGAAATATAGTGGAAACCGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000511.5-1626s21c1
Sequence:CCGGTGGGTTCAAAGACCATAATCACTCGAGTGATTATGGTCTTTGAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000511
FUT2 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 2 (secretor status included)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-195s1c1
Sequence:CCGGCCTGTTCACTATCAACTCCAACTCGAGTTGGAGTTGATAGTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-834s1c1
Sequence:CCGGTGCTCTACTCACACAGTGTAACTCGAGTTACACTGTGTGAGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-621s1c1
Sequence:CCGGCTATGTCCATGTCATGCCAAACTCGAGTTTGGCATGACATGGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-58s1c1
Sequence:CCGGTCCACCTTCTACTTCGTCTTTCTCGAGAAAGACGAAGTAGAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-1136s21c1
Sequence:CCGGCCCTTACTCAAGCACTAATGCCTCGAGGCATTAGTGCTTGAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-260s21c1
Sequence:CCGGGTGCTAGCCTCAACATCAAAGCTCGAGCTTTGATGTTGAGGCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-179s21c1
Sequence:CCGGTTTACGGTTTCCACTATATTTCTCGAGAAATATAGTGGAAACCGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000511.5-1626s21c1
Sequence:CCGGTGGGTTCAAAGACCATAATCACTCGAGTGATTATGGTCTTTGAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000511
FUT2 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 2 (secretor status included)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-195s1c1
Sequence:CCGGCCTGTTCACTATCAACTCCAACTCGAGTTGGAGTTGATAGTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-834s1c1
Sequence:CCGGTGCTCTACTCACACAGTGTAACTCGAGTTACACTGTGTGAGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-621s1c1
Sequence:CCGGCTATGTCCATGTCATGCCAAACTCGAGTTTGGCATGACATGGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000511.1-58s1c1
Sequence:CCGGTCCACCTTCTACTTCGTCTTTCTCGAGAAAGACGAAGTAGAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-1136s21c1
Sequence:CCGGCCCTTACTCAAGCACTAATGCCTCGAGGCATTAGTGCTTGAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-260s21c1
Sequence:CCGGGTGCTAGCCTCAACATCAAAGCTCGAGCTTTGATGTTGAGGCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000511.5-179s21c1
Sequence:CCGGTTTACGGTTTCCACTATATTTCTCGAGAAATATAGTGGAAACCGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000511.5-1626s21c1
Sequence:CCGGTGGGTTCAAAGACCATAATCACTCGAGTGATTATGGTCTTTGAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018876
FUT2 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 2 (secretor status included)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018876.2-1700s1c1
Sequence:CCGGCGTCTTATCATCTGTTAAGATCTCGAGATCTTAACAGATGATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-306s1c1
Sequence:CCGGGCAGGGCATATTCACGATCAACTCGAGTTGATCGTGAATATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-248s1c1
Sequence:CCGGCGGTTCAAATGTCCTCACCAACTCGAGTTGGTGAGGACATTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-843s1c1
Sequence:CCGGCGTGGTTACAAGCAACGGTATCTCGAGATACCGTTGCTTGTAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-198s1c1
Sequence:CCGGCCAGCAACGAATAGTGAAGCTCTCGAGAGCTTCACTATTCGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018876
FUT2 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 2 (secretor status included)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018876.2-1700s1c1
Sequence:CCGGCGTCTTATCATCTGTTAAGATCTCGAGATCTTAACAGATGATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-306s1c1
Sequence:CCGGGCAGGGCATATTCACGATCAACTCGAGTTGATCGTGAATATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-248s1c1
Sequence:CCGGCGGTTCAAATGTCCTCACCAACTCGAGTTGGTGAGGACATTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-843s1c1
Sequence:CCGGCGTGGTTACAAGCAACGGTATCTCGAGATACCGTTGCTTGTAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-198s1c1
Sequence:CCGGCCAGCAACGAATAGTGAAGCTCTCGAGAGCTTCACTATTCGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018876
FUT2 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 2 (secretor status included)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018876.2-1700s1c1
Sequence:CCGGCGTCTTATCATCTGTTAAGATCTCGAGATCTTAACAGATGATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-306s1c1
Sequence:CCGGGCAGGGCATATTCACGATCAACTCGAGTTGATCGTGAATATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-248s1c1
Sequence:CCGGCGGTTCAAATGTCCTCACCAACTCGAGTTGGTGAGGACATTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-843s1c1
Sequence:CCGGCGTGGTTACAAGCAACGGTATCTCGAGATACCGTTGCTTGTAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018876.2-198s1c1
Sequence:CCGGCCAGCAACGAATAGTGAAGCTCTCGAGAGCTTCACTATTCGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks