EMAIL THIS PAGE TO A FRIEND

FUT3

fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)

37 Gene Product Result for
Synonyms: CD174 FT3B FucT-III LE Les
Species: Human FUT3(2525), sheep FUT3(101108745), naked mole-rat Fut3(101727627), Thale Cress FUT3(843783)
UniProtKB ID: P21217, B5U7U9, B5U7V0, Q32NE7, Q99448, Q99449
Gene ID:
Human(2525) Summary: The Lewis histo-blood group system comprises a set of fucosylated glycosphingolipids that are synthesized by exocrine epithelial cells and circulate in body fluids. The glycosphingolipids function in embryogenesis, tissue differentiation, tumor metastasis, inflammation, and bacterial adhesion. They are secondarily absorbed to red blood cells giving rise to their Lewis phenotype. This gene is a member of the fucosyltransferase family, which catalyzes the addition of fucose to precursor polysaccharides in the last step of Lewis antigen biosynthesis. It encodes an enzyme with alpha(1,3)-fucosyltransferase and alpha(1,4)-fucosyltransferase activities. Mutations in this gene are responsible for the majority of Lewis antigen-negative phenotypes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
sheep(101108745) fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)
naked mole-rat(101727627) fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)
Thale Cress(843783) fucosyltransferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000149 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032681 MISSION® esiRNA esiRNA human FUT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000149 Rosetta Predictions human pricing
NM_001097639 Rosetta Predictions human pricing
NM_001097640 Rosetta Predictions human pricing
NM_001097641 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165271 predicted 858
2 SASI_Hs01_00165272 predicted 1024
3 SASI_Hs01_00165274 predicted 1815
4 SASI_Hs01_00165275 predicted 2167
5 SASI_Hs01_00165276 predicted 2216
6 SASI_Hs01_00165277 predicted 2214
7 SASI_Hs01_00165273 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318540 predicted 515
2 SASI_Hs02_00318541 predicted 676
3 SASI_Hs02_00318542 predicted 1461
4 SASI_Hs02_00318543 predicted 1816
5 SASI_Hs02_00318544 predicted 1872
6 SASI_Hs02_00318545 predicted 1872
7 SASI_Hs02_00318546 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318547 predicted 456
2 SASI_Hs02_00318548 predicted 621
3 SASI_Hs02_00318549 predicted 1410
4 SASI_Hs02_00318550 predicted 1766
5 SASI_Hs02_00318551 predicted 1821
6 SASI_Hs02_00318552 predicted 1814
7 SASI_Hs02_00318553 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318554 predicted 322
2 SASI_Hs02_00318555 predicted 487
3 SASI_Hs02_00318556 predicted 1268
4 SASI_Hs02_00318557 predicted 1630
5 SASI_Hs02_00318558 predicted 1674
6 SASI_Hs02_00318559 predicted 1681
7 SASI_Hs02_00318560 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000149
FUT3 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000149.3-2186s21c1
Sequence:CCGGCACGGTTTCCAGATGTAATACCTCGAGGTATTACATCTGGAAACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1022s1c1
Sequence:CCGGGCGCTGGATCTGGTTCAACTTCTCGAGAAGTTGAACCAGATCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1074s1c1
Sequence:CCGGGCCCTGGACAGATACTTCAATCTCGAGATTGAAGTATCTGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-837s1c1
Sequence:CCGGACATGGCCTTTCCACATCCCTCTCGAGAGGGATGTGGAAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-686s1c1
Sequence:CCGGCGCACTGCTATTTCAGCTGCTCTCGAGAGCAGCTGAAATAGCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1572s1c1
Sequence:CCGGGCCCGCTACCTGAGCTACTTTCTCGAGAAAGTAGCTCAGGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000149
FUT3 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000149.3-2186s21c1
Sequence:CCGGCACGGTTTCCAGATGTAATACCTCGAGGTATTACATCTGGAAACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1022s1c1
Sequence:CCGGGCGCTGGATCTGGTTCAACTTCTCGAGAAGTTGAACCAGATCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1074s1c1
Sequence:CCGGGCCCTGGACAGATACTTCAATCTCGAGATTGAAGTATCTGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-837s1c1
Sequence:CCGGACATGGCCTTTCCACATCCCTCTCGAGAGGGATGTGGAAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-686s1c1
Sequence:CCGGCGCACTGCTATTTCAGCTGCTCTCGAGAGCAGCTGAAATAGCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1572s1c1
Sequence:CCGGGCCCGCTACCTGAGCTACTTTCTCGAGAAAGTAGCTCAGGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000149
FUT3 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000149.3-2186s21c1
Sequence:CCGGCACGGTTTCCAGATGTAATACCTCGAGGTATTACATCTGGAAACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1022s1c1
Sequence:CCGGGCGCTGGATCTGGTTCAACTTCTCGAGAAGTTGAACCAGATCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1074s1c1
Sequence:CCGGGCCCTGGACAGATACTTCAATCTCGAGATTGAAGTATCTGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-837s1c1
Sequence:CCGGACATGGCCTTTCCACATCCCTCTCGAGAGGGATGTGGAAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-686s1c1
Sequence:CCGGCGCACTGCTATTTCAGCTGCTCTCGAGAGCAGCTGAAATAGCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000149.1-1572s1c1
Sequence:CCGGGCCCGCTACCTGAGCTACTTTCTCGAGAAAGTAGCTCAGGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks