EMAIL THIS PAGE TO A FRIEND

FUT4

fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)

209 Gene Product Result for
Synonyms: CD15 ELFT FCT3A FUC-TIV FUTIV LeX SSEA-1
UniProtKB ID: P22083, B2RMS0
Gene ID:
Human(2526) Summary: The product of this gene transfers fucose to N-acetyllactosamine polysaccharides to generate fucosylated carbohydrate structures. It catalyzes the synthesis of the non-sialylated antigen, Lewis x (CD15). [provided by RefSeq, Jan 2009]
Mouse(14345) fucosyltransferase 4
Rat(60670) fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Thale Cress(816031) probable fucosyltransferase 4
cow(282854) fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
chicken(428092) fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002033 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003671 MISSION® esiRNA esiRNA targeting human FUT4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002033 Rosetta Predictions human pricing
NM_022219 Rosetta Predictions rat pricing
NM_010242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031319 predicted 1892
2 SASI_Hs01_00031320 predicted 2034
3 SASI_Hs01_00031321 predicted 2029
4 SASI_Hs01_00031322 predicted 1044
5 SASI_Hs01_00031323 predicted 1375
6 SASI_Hs01_00031324 predicted 2251
7 SASI_Hs01_00031325 predicted 1899
8 SASI_Hs01_00031326 predicted 2157
9 SASI_Hs01_00031327 predicted 1105
10 SASI_Hs01_00031328 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064792 predicted 1915
2 SASI_Rn01_00064794 predicted 1652
3 SASI_Rn01_00064795 predicted 1727
4 SASI_Rn01_00064796 predicted 1033
5 SASI_Rn01_00064797 predicted 1729
6 SASI_Rn01_00064798 predicted 1501
7 SASI_Rn01_00064799 predicted 1913
8 SASI_Rn01_00064800 predicted 1329
9 SASI_Rn01_00064801 predicted 1662
10 SASI_Rn02_00262977 predicted 1547
11 SASI_Rn01_00064793 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171014 predicted 1490
2 SASI_Mm01_00171015 predicted 1868
3 SASI_Mm01_00171016 predicted 1265
4 SASI_Mm01_00171017 predicted 1497
5 SASI_Mm01_00171018 predicted 1708
6 SASI_Mm01_00171019 predicted 1424
7 SASI_Mm01_00171020 predicted 1076
8 SASI_Mm01_00171021 predicted 1697
9 SASI_Mm01_00171022 predicted 1916
10 SASI_Mm02_00318114 predicted 841
11 SASI_Mm01_00171023 predicted 1736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010242
FUT4 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010242.2-2844s1c1
Sequence:CCGGCCCAAGATTAACTGACTGTATCTCGAGATACAGTCAGTTAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-601s1c1
Sequence:CCGGCGCACGGATAAGGCGCTGGTACTCGAGTACCAGCGCCTTATCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-816s1c1
Sequence:CCGGCGTGCCCTATGGCTTCCTCTACTCGAGTAGAGGAAGCCATAGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-1248s1c1
Sequence:CCGGCCTGCTCTTTCTCGACCGAAACTCGAGTTTCGGTCGAGAAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-1089s1c1
Sequence:CCGGCGTGGATTACATCACCGAGAACTCGAGTTCTCGGTGATGTAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010242
FUT4 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010242.2-2844s1c1
Sequence:CCGGCCCAAGATTAACTGACTGTATCTCGAGATACAGTCAGTTAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-601s1c1
Sequence:CCGGCGCACGGATAAGGCGCTGGTACTCGAGTACCAGCGCCTTATCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-816s1c1
Sequence:CCGGCGTGCCCTATGGCTTCCTCTACTCGAGTAGAGGAAGCCATAGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-1248s1c1
Sequence:CCGGCCTGCTCTTTCTCGACCGAAACTCGAGTTTCGGTCGAGAAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-1089s1c1
Sequence:CCGGCGTGGATTACATCACCGAGAACTCGAGTTCTCGGTGATGTAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010242
FUT4 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010242.2-2844s1c1
Sequence:CCGGCCCAAGATTAACTGACTGTATCTCGAGATACAGTCAGTTAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-601s1c1
Sequence:CCGGCGCACGGATAAGGCGCTGGTACTCGAGTACCAGCGCCTTATCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-816s1c1
Sequence:CCGGCGTGCCCTATGGCTTCCTCTACTCGAGTAGAGGAAGCCATAGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-1248s1c1
Sequence:CCGGCCTGCTCTTTCTCGACCGAAACTCGAGTTTCGGTCGAGAAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010242.2-1089s1c1
Sequence:CCGGCGTGGATTACATCACCGAGAACTCGAGTTCTCGGTGATGTAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002033
FUT4 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1427s1c1
Sequence:CCGGCCTGGATTATATCACCGAGAACTCGAGTTCTCGGTGATATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-5558s1c2
Sequence:CCGGCCTAAGGTTGAAAGTGCTTATCTCGAGATAAGCACTTTCAACCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-4886s1c1
Sequence:CCGGCGGTCTGACTTGCTTTCAGTACTCGAGTACTGAAAGCAAGTCAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1097s1c1
Sequence:CCGGCCTGGCAAGTAACCTCTTCAACTCGAGTTGAAGAGGTTACTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-2328s1c1
Sequence:CCGGCGCTGACTTCTTTCACAAGTACTCGAGTACTTGTGAAAGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1424s1c1
Sequence:CCGGGCACCTGGATTATATCACCGACTCGAGTCGGTGATATAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1420s1c1
Sequence:CCGGCGCAGCACCTGGATTATATCACTCGAGTGATATAATCCAGGTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002033
FUT4 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1427s1c1
Sequence:CCGGCCTGGATTATATCACCGAGAACTCGAGTTCTCGGTGATATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-5558s1c2
Sequence:CCGGCCTAAGGTTGAAAGTGCTTATCTCGAGATAAGCACTTTCAACCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-4886s1c1
Sequence:CCGGCGGTCTGACTTGCTTTCAGTACTCGAGTACTGAAAGCAAGTCAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1097s1c1
Sequence:CCGGCCTGGCAAGTAACCTCTTCAACTCGAGTTGAAGAGGTTACTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-2328s1c1
Sequence:CCGGCGCTGACTTCTTTCACAAGTACTCGAGTACTTGTGAAAGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1424s1c1
Sequence:CCGGGCACCTGGATTATATCACCGACTCGAGTCGGTGATATAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1420s1c1
Sequence:CCGGCGCAGCACCTGGATTATATCACTCGAGTGATATAATCCAGGTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002033
FUT4 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1427s1c1
Sequence:CCGGCCTGGATTATATCACCGAGAACTCGAGTTCTCGGTGATATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-5558s1c2
Sequence:CCGGCCTAAGGTTGAAAGTGCTTATCTCGAGATAAGCACTTTCAACCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-4886s1c1
Sequence:CCGGCGGTCTGACTTGCTTTCAGTACTCGAGTACTGAAAGCAAGTCAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1097s1c1
Sequence:CCGGCCTGGCAAGTAACCTCTTCAACTCGAGTTGAAGAGGTTACTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002033.2-2328s1c1
Sequence:CCGGCGCTGACTTCTTTCACAAGTACTCGAGTACTTGTGAAAGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1424s1c1
Sequence:CCGGGCACCTGGATTATATCACCGACTCGAGTCGGTGATATAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002033.2-1420s1c1
Sequence:CCGGCGCAGCACCTGGATTATATCACTCGAGTGATATAATCCAGGTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks