EMAIL THIS PAGE TO A FRIEND

FUT5

fucosyltransferase 5 (alpha (1,3) fucosyltransferase)

22 Gene Product Result for
Synonyms: FUC-TV
UniProtKB ID: Q11128, A8K4X2
Gene ID:
naked mole-rat(101714266) fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
Thale Cress(816029) probable fucosyltransferase 5
cow(338077) fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
dog(449024) fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
chicken(428341) fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002034 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108821 MISSION® esiRNA esiRNA human FUT5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002034 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125271 predicted 1377
2 SASI_Hs01_00125272 predicted 1361
3 SASI_Hs01_00125273 predicted 1619
4 SASI_Hs01_00125274 predicted 1258
5 SASI_Hs01_00125275 predicted 1395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002034
FUT5 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-406s1c1
Sequence:CCGGCACTGCCGACTCCAGTGTGTACTCGAGTACACACTGGAGTCGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-399s1c1
Sequence:CCGGGCAACATCACTGCCGACTCCACTCGAGTGGAGTCGGCAGTGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-454s1c1
Sequence:CCGGCCACTGGGATATCATGTACAACTCGAGTTGTACATGATATCCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-847s1c1
Sequence:CCGGGTACAAGTTCTATCTGGCCTTCTCGAGAAGGCCAGATAGAACTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-958s1c1
Sequence:CCGGCAGAAGCAACTACGAGAGGTTCTCGAGAACCTCTCGTAGTTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002034.2-1560s21c1
Sequence:CCGGGAGACCTTGCCACACTGAATGCTCGAGCATTCAGTGTGGCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002034.2-1153s21c1
Sequence:CCGGGAAGCTGCAGCAGGAATCTAGCTCGAGCTAGATTCCTGCTGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002034
FUT5 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-406s1c1
Sequence:CCGGCACTGCCGACTCCAGTGTGTACTCGAGTACACACTGGAGTCGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-399s1c1
Sequence:CCGGGCAACATCACTGCCGACTCCACTCGAGTGGAGTCGGCAGTGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-454s1c1
Sequence:CCGGCCACTGGGATATCATGTACAACTCGAGTTGTACATGATATCCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-847s1c1
Sequence:CCGGGTACAAGTTCTATCTGGCCTTCTCGAGAAGGCCAGATAGAACTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-958s1c1
Sequence:CCGGCAGAAGCAACTACGAGAGGTTCTCGAGAACCTCTCGTAGTTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002034.2-1560s21c1
Sequence:CCGGGAGACCTTGCCACACTGAATGCTCGAGCATTCAGTGTGGCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002034.2-1153s21c1
Sequence:CCGGGAAGCTGCAGCAGGAATCTAGCTCGAGCTAGATTCCTGCTGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002034
FUT5 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-406s1c1
Sequence:CCGGCACTGCCGACTCCAGTGTGTACTCGAGTACACACTGGAGTCGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-399s1c1
Sequence:CCGGGCAACATCACTGCCGACTCCACTCGAGTGGAGTCGGCAGTGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-454s1c1
Sequence:CCGGCCACTGGGATATCATGTACAACTCGAGTTGTACATGATATCCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-847s1c1
Sequence:CCGGGTACAAGTTCTATCTGGCCTTCTCGAGAAGGCCAGATAGAACTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002034.1-958s1c1
Sequence:CCGGCAGAAGCAACTACGAGAGGTTCTCGAGAACCTCTCGTAGTTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002034.2-1560s21c1
Sequence:CCGGGAGACCTTGCCACACTGAATGCTCGAGCATTCAGTGTGGCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002034.2-1153s21c1
Sequence:CCGGGAAGCTGCAGCAGGAATCTAGCTCGAGCTAGATTCCTGCTGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks