EMAIL THIS PAGE TO A FRIEND

FUT6

fucosyltransferase 6 (alpha (1,3) fucosyltransferase)

32 Gene Product Result for
Synonyms: FCT3A FT1A Fuc-TVI FucT-VI
Species: Human FUT6(2528), Thale Cress FUT6(837968)
UniProtKB ID: P51993, A6NEX0, D6W637, Q9UND8
Gene ID:
Human(2528) Summary: The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of sialyl-Lewis X, an E-selectin ligand. Mutations in this gene are a cause of fucosyltransferase-6 deficiency. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Thale Cress(837968) fucosyltransferase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000150 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000150 Rosetta Predictions human pricing
NM_001040701 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073050 predicted 2435
2 SASI_Hs01_00073051 predicted 2476
3 SASI_Hs01_00073052 predicted 2495
4 SASI_Hs01_00073053 predicted 2405
5 SASI_Hs01_00073054 predicted 2330
6 SASI_Hs01_00073055 predicted 2342
7 SASI_Hs01_00073056 predicted 2233
8 SASI_Hs01_00073057 predicted 1618
9 SASI_Hs01_00073058 predicted 1282
10 SASI_Hs01_00073059 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174736 predicted 2307
2 SASI_Hs01_00174737 predicted 2348
3 SASI_Hs01_00174738 predicted 2368
4 SASI_Hs01_00174739 predicted 2271
5 SASI_Hs01_00174740 predicted 2211
6 SASI_Hs01_00174741 predicted 2217
7 SASI_Hs01_00174742 predicted 2102
8 SASI_Hs01_00174743 predicted 1493
9 SASI_Hs01_00174744 predicted 1160
10 SASI_Hs01_00174745 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000150
FUT6 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 6 (alpha (1,3) fucosyltransferase)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000150.2-2739s21c1
Sequence:CCGGCACCCATGAGTGATGGTTCTGCTCGAGCAGAACCATCACTCATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000150.2-1407s21c1
Sequence:CCGGTTAACAAACCCATAGCTCTGCCTCGAGGCAGAGCTATGGGTTTGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000150.2-1452s21c1
Sequence:CCGGGCACGGCTGACTGCAACATCACTCGAGTGATGTTGCAGTCAGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1271s1c1
Sequence:CCGGGATCCCACTGTGTACCCTAATCTCGAGATTAGGGTACACAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1474s1c1
Sequence:CCGGGCACCACCGAGAGGTCATGTACTCGAGTACATGACCTCTCGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1232s1c1
Sequence:CCGGGCTGTGTGTTTCTTCTCCTATCTCGAGATAGGAGAAGAAACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-2195s1c1
Sequence:CCGGAGGTACCAGACACGCGGCATACTCGAGTATGCCGCGTGTCTGGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1600s1c1
Sequence:CCGGCGGATACTTCAATCTCACCATCTCGAGATGGTGAGATTGAAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000150
FUT6 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 6 (alpha (1,3) fucosyltransferase)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000150.2-2739s21c1
Sequence:CCGGCACCCATGAGTGATGGTTCTGCTCGAGCAGAACCATCACTCATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000150.2-1407s21c1
Sequence:CCGGTTAACAAACCCATAGCTCTGCCTCGAGGCAGAGCTATGGGTTTGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000150.2-1452s21c1
Sequence:CCGGGCACGGCTGACTGCAACATCACTCGAGTGATGTTGCAGTCAGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1271s1c1
Sequence:CCGGGATCCCACTGTGTACCCTAATCTCGAGATTAGGGTACACAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1474s1c1
Sequence:CCGGGCACCACCGAGAGGTCATGTACTCGAGTACATGACCTCTCGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1232s1c1
Sequence:CCGGGCTGTGTGTTTCTTCTCCTATCTCGAGATAGGAGAAGAAACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-2195s1c1
Sequence:CCGGAGGTACCAGACACGCGGCATACTCGAGTATGCCGCGTGTCTGGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1600s1c1
Sequence:CCGGCGGATACTTCAATCTCACCATCTCGAGATGGTGAGATTGAAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000150
FUT6 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 6 (alpha (1,3) fucosyltransferase)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000150.2-2739s21c1
Sequence:CCGGCACCCATGAGTGATGGTTCTGCTCGAGCAGAACCATCACTCATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000150.2-1407s21c1
Sequence:CCGGTTAACAAACCCATAGCTCTGCCTCGAGGCAGAGCTATGGGTTTGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000150.2-1452s21c1
Sequence:CCGGGCACGGCTGACTGCAACATCACTCGAGTGATGTTGCAGTCAGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1271s1c1
Sequence:CCGGGATCCCACTGTGTACCCTAATCTCGAGATTAGGGTACACAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1474s1c1
Sequence:CCGGGCACCACCGAGAGGTCATGTACTCGAGTACATGACCTCTCGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1232s1c1
Sequence:CCGGGCTGTGTGTTTCTTCTCCTATCTCGAGATAGGAGAAGAAACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-2195s1c1
Sequence:CCGGAGGTACCAGACACGCGGCATACTCGAGTATGCCGCGTGTCTGGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000150.1-1600s1c1
Sequence:CCGGCGGATACTTCAATCTCACCATCTCGAGATGGTGAGATTGAAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks