EMAIL THIS PAGE TO A FRIEND

FUT7

fucosyltransferase 7 (alpha (1,3) fucosyltransferase)

54 Gene Product Result for
Synonyms: FucT-VII
UniProtKB ID: Q11130, B2R7U7, Q6DK54
Gene ID:
Human(2529) Summary: The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of sialyl-Lewis X antigens. The encoded protein can direct the synthesis of the E-selectin-binding sialyl-Lewis X moiety. [provided by RefSeq, Jul 2008]
Mouse(14347) fucosyltransferase 7
Rat(296564) fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Zebrafish(562250) fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
cow(100036592) fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
dog(449026) fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
chicken(427782) fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Thale Cress(837967) fucosyltransferase 7
naked mole-rat(101696730) fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004479 Rosetta Predictions human pricing
NM_199491 Rosetta Predictions rat pricing
NM_013524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105535 predicted 1736
2 SASI_Hs01_00105536 predicted 973
3 SASI_Hs01_00105537 predicted 1564
4 SASI_Hs01_00105538 predicted 1283
5 SASI_Hs01_00105539 predicted 1550
6 SASI_Hs01_00105540 predicted 1724
7 SASI_Hs01_00105541 predicted 2122
8 SASI_Hs01_00105542 predicted 1846
9 SASI_Hs01_00105543 predicted 1784
10 SASI_Hs01_00105544 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030258 predicted 455
2 SASI_Rn01_00030259 predicted 1493
3 SASI_Rn01_00030260 predicted 553
4 SASI_Rn01_00030261 predicted 927
5 SASI_Rn01_00030262 predicted 1042
6 SASI_Rn01_00030263 predicted 714
7 SASI_Rn02_00270257 predicted 554
8 SASI_Rn01_00030264 predicted 1591
9 SASI_Rn01_00030265 predicted 1282
10 SASI_Rn01_00030266 predicted 1267
11 SASI_Rn01_00030267 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322215 predicted 947
2 SASI_Mm02_00322216 predicted 1746
3 SASI_Mm02_00322217 predicted 1044
4 SASI_Mm01_00123193 predicted 1833
5 SASI_Mm01_00123194 predicted 1110
6 SASI_Mm02_00322218 predicted 1894
7 SASI_Mm01_00123195 predicted 1545
8 SASI_Mm02_00322219 predicted 1268
9 SASI_Mm01_00123196 predicted 1101
10 SASI_Mm02_00322220 predicted 929
11 SASI_Mm01_00123192 predicted 1900
12 SASI_Mm01_00123197 predicted 1397
13 SASI_Mm01_00123198 predicted 1246
14 SASI_Mm01_00123199 predicted 1058
15 SASI_Mm01_00123200 predicted 1692
16 SASI_Mm01_00123201 predicted 1868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004479
FUT7 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-822s1c1
Sequence:CCGGCGCGACTACATTACGGAGAAACTCGAGTTTCTCCGTAATGTAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-797s1c1
Sequence:CCGGCCTGTCCTTTGAGAACTCTCACTCGAGTGAGAGTTCTCAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-702s1c1
Sequence:CCGGGCGCCTCATCTGCGGGTGGATCTCGAGATCCACCCGCAGATGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004479.3-2126s21c1
Sequence:CCGGACAAATCTTGGGTGGGTGAAGCTCGAGCTTCACCCACCCAAGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004479.3-984s21c1
Sequence:CCGGCACGATCACCATCCTTGTCTGCTCGAGCAGACAAGGATGGTGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004479.3-1915s21c1
Sequence:CCGGGGCTGGGTGTCGAAATCAAACCTCGAGGTTTGATTTCGACACCCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004479.3-1244s21c1
Sequence:CCGGACCTCCGAGGCATCTTCAACTCTCGAGAGTTGAAGATGCCTCGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004479
FUT7 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-822s1c1
Sequence:CCGGCGCGACTACATTACGGAGAAACTCGAGTTTCTCCGTAATGTAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-797s1c1
Sequence:CCGGCCTGTCCTTTGAGAACTCTCACTCGAGTGAGAGTTCTCAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-702s1c1
Sequence:CCGGGCGCCTCATCTGCGGGTGGATCTCGAGATCCACCCGCAGATGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004479.3-2126s21c1
Sequence:CCGGACAAATCTTGGGTGGGTGAAGCTCGAGCTTCACCCACCCAAGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004479.3-984s21c1
Sequence:CCGGCACGATCACCATCCTTGTCTGCTCGAGCAGACAAGGATGGTGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004479.3-1915s21c1
Sequence:CCGGGGCTGGGTGTCGAAATCAAACCTCGAGGTTTGATTTCGACACCCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004479.3-1244s21c1
Sequence:CCGGACCTCCGAGGCATCTTCAACTCTCGAGAGTTGAAGATGCCTCGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004479
FUT7 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-822s1c1
Sequence:CCGGCGCGACTACATTACGGAGAAACTCGAGTTTCTCCGTAATGTAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-797s1c1
Sequence:CCGGCCTGTCCTTTGAGAACTCTCACTCGAGTGAGAGTTCTCAAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004479.1-702s1c1
Sequence:CCGGGCGCCTCATCTGCGGGTGGATCTCGAGATCCACCCGCAGATGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004479.3-2126s21c1
Sequence:CCGGACAAATCTTGGGTGGGTGAAGCTCGAGCTTCACCCACCCAAGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004479.3-984s21c1
Sequence:CCGGCACGATCACCATCCTTGTCTGCTCGAGCAGACAAGGATGGTGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004479.3-1915s21c1
Sequence:CCGGGGCTGGGTGTCGAAATCAAACCTCGAGGTTTGATTTCGACACCCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004479.3-1244s21c1
Sequence:CCGGACCTCCGAGGCATCTTCAACTCTCGAGAGTTGAAGATGCCTCGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013524
FUT7 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013524.1-1895s1c1
Sequence:CCGGCCAGGATAAGAGACAATGAATCTCGAGATTCATTGTCTCTTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1676s1c1
Sequence:CCGGCAGGTCTATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-745s1c1
Sequence:CCGGAGGAGCAACATTCATGGTAATCTCGAGATTACCATGAATGTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1550s1c1
Sequence:CCGGAGCATGAATGAGAGTCGTTATCTCGAGATAACGACTCTCATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1115s1c1
Sequence:CCGGCGGCGTGATTCAGATATCTTTCTCGAGAAAGATATCTGAATCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013524
FUT7 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013524.1-1895s1c1
Sequence:CCGGCCAGGATAAGAGACAATGAATCTCGAGATTCATTGTCTCTTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1676s1c1
Sequence:CCGGCAGGTCTATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-745s1c1
Sequence:CCGGAGGAGCAACATTCATGGTAATCTCGAGATTACCATGAATGTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1550s1c1
Sequence:CCGGAGCATGAATGAGAGTCGTTATCTCGAGATAACGACTCTCATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1115s1c1
Sequence:CCGGCGGCGTGATTCAGATATCTTTCTCGAGAAAGATATCTGAATCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013524
FUT7 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 7 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013524.1-1895s1c1
Sequence:CCGGCCAGGATAAGAGACAATGAATCTCGAGATTCATTGTCTCTTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1676s1c1
Sequence:CCGGCAGGTCTATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-745s1c1
Sequence:CCGGAGGAGCAACATTCATGGTAATCTCGAGATTACCATGAATGTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1550s1c1
Sequence:CCGGAGCATGAATGAGAGTCGTTATCTCGAGATAACGACTCTCATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013524.1-1115s1c1
Sequence:CCGGCGGCGTGATTCAGATATCTTTCTCGAGAAAGATATCTGAATCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks