EMAIL THIS PAGE TO A FRIEND

FUT8

fucosyltransferase 8 (alpha (1,6) fucosyltransferase)

Gene ID:
Human(2530) Summary: This gene encodes an enzyme belonging to the family of fucosyltransferases. The product of this gene catalyzes the transfer of fucose from GDP-fucose to N-linked type complex glycopeptides. This enzyme is distinct from other fucosyltransferases which catalyze alpha1-2, alpha1-3, and alpha1-4 fucose addition. The expression of this gene may contribute to the malignancy of cancer cells and to their invasive and metastatic capabilities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
Mouse(53618) fucosyltransferase 8
Rat(432392) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
sheep(101111372) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Domestic Rabbit(100341974) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
domestic guinea pig(100714958) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
naked mole-rat(101697170) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Zebrafish(797512) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Thale Cress(5007694) fucosyltransferase 8
chicken(423178) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
cow(281177) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Horse(100052546) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
domestic cat(101089525) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
dog(448804) fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004480 Rosetta Predictions human pricing
NM_178154 Rosetta Predictions human pricing
NM_178155 Rosetta Predictions human pricing
NM_178156 Rosetta Predictions human pricing
NM_178157 Rosetta Predictions human pricing
NM_001002289 Rosetta Predictions rat pricing
XM_579076 Rosetta Predictions rat pricing
NM_016893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246457 predicted 1985
2 SASI_Hs01_00246458 predicted 2162
3 SASI_Hs01_00246459 predicted 1896
4 SASI_Hs01_00246461 predicted 2040
5 SASI_Hs02_00337699 predicted 2042
6 SASI_Hs01_00246462 predicted 1864
7 SASI_Hs02_00337700 predicted 1991
8 SASI_Hs01_00246463 predicted 2334
9 SASI_Hs01_00246464 predicted 2052
10 SASI_Hs01_00246466 predicted 2168
11 SASI_Hs01_00246460 predicted 2152
12 SASI_Hs01_00246465 predicted 2272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164286 predicted 2317
2 SASI_Hs01_00164287 predicted 2485
3 SASI_Hs01_00164288 predicted 2217
4 SASI_Hs01_00164290 predicted 2374
5 SASI_Hs02_00369559 predicted 2368
6 SASI_Hs01_00164291 predicted 2192
7 SASI_Hs02_00369560 predicted 2319
8 SASI_Hs01_00164292 predicted 2659
9 SASI_Hs01_00164293 predicted 2379
10 SASI_Hs01_00164295 predicted 2495
11 SASI_Hs01_00164289 predicted 2475
12 SASI_Hs01_00164294 predicted 2594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106157 predicted 2791
2 SASI_Hs01_00106158 predicted 2959
3 SASI_Hs01_00106159 predicted 2695
4 SASI_Hs01_00106161 predicted 2847
5 SASI_Hs02_00369561 predicted 2841
6 SASI_Hs01_00106162 predicted 2668
7 SASI_Hs02_00369562 predicted 2784
8 SASI_Hs01_00106163 predicted 3136
9 SASI_Hs01_00106164 predicted 2853
10 SASI_Hs01_00106166 predicted 2968
11 SASI_Hs01_00106160 predicted 2950
12 SASI_Hs01_00106165 predicted 3075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043012 predicted 2693
2 SASI_Hs01_00043013 predicted 2862
3 SASI_Hs01_00043014 predicted 2595
4 SASI_Hs01_00043016 predicted 2748
5 SASI_Hs02_00369563 predicted 2745
6 SASI_Hs01_00043017 predicted 2568
7 SASI_Hs02_00369564 predicted 2692
8 SASI_Hs01_00043018 predicted 3034
9 SASI_Hs01_00043019 predicted 2753
10 SASI_Hs01_00043021 predicted 2874
11 SASI_Hs01_00043015 predicted 2851
12 SASI_Hs01_00043020 predicted 2971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203034 predicted 403
2 SASI_Hs01_00203035 predicted 567
3 SASI_Hs01_00203036 predicted 302
4 SASI_Hs01_00203038 predicted 455
5 SASI_Hs02_00369565 predicted 450
6 SASI_Hs01_00203039 predicted 273
7 SASI_Hs02_00369566 predicted 394
8 SASI_Hs01_00203040 predicted 743
9 SASI_Hs01_00203041 predicted 465
10 SASI_Hs01_00203043 predicted 579
11 SASI_Hs01_00203037 predicted 562
12 SASI_Hs01_00203042 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052808 predicted 1198
2 SASI_Rn01_00052809 predicted 472
3 SASI_Rn01_00052810 predicted 399
4 SASI_Rn01_00052811 predicted 487
5 SASI_Rn01_00052812 predicted 548
6 SASI_Rn01_00052813 predicted 364
7 SASI_Rn01_00052814 predicted 1179
8 SASI_Rn01_00052815 predicted 1057
9 SASI_Rn01_00052816 predicted 733
10 SASI_Rn01_00052817 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190878 predicted 1479
2 SASI_Rn01_00190879 predicted 1213
3 SASI_Rn01_00190880 predicted 1249
4 SASI_Rn01_00190881 predicted 1187
5 SASI_Rn01_00190882 predicted 1063
6 SASI_Rn01_00190883 predicted 740
7 SASI_Rn01_00190884 predicted 1306
8 SASI_Rn01_00190885 predicted 1461
9 SASI_Rn01_00190886 predicted 1050
10 SASI_Rn01_00190887 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189384 predicted 675
2 SASI_Mm01_00189385 predicted 2260
3 SASI_Mm01_00189386 predicted 2440
4 SASI_Mm01_00189387 predicted 2114
5 SASI_Mm01_00189388 predicted 2337
6 SASI_Mm02_00323725 predicted 1200
7 SASI_Mm01_00189389 predicted 1871
8 SASI_Mm01_00189390 predicted 1007
9 SASI_Mm01_00189391 predicted 1834
10 SASI_Mm01_00189392 predicted 2182
11 SASI_Mm01_00189393 predicted 1140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016893
VALIDATED
FUT8 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016893.4-730s21c1
Sequence:CCGGTGGTCATTTGGTTCGAGATAACTCGAGTTATCTCGAACCAAATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-1835s21c1
Sequence:CCGGCGCAGAATGCAAGTGGATAAACTCGAGTTTATCCACTTGCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-2555s21c1
Sequence:CCGGGCCCATACACAGTACAATAATCTCGAGATTATTGTACTGTGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-2114s21c1
Sequence:CCGGGCGAACTTCCATTCTTTGGATCTCGAGATCCAAAGAATGGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-1279s21c1
Sequence:CCGGGCTGGTGTGTAACATCAATAACTCGAGTTATTGATGTTACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-1280s1c1
Sequence:CCGGGCTGGTGTGTAACATCAATAACTCGAGTTATTGATGTTACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-2556s1c1
Sequence:CCGGGCCCATACACAGTACAATAATCTCGAGATTATTGTACTGTGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016893.2-744s1c1
Sequence:CCGGCGAGATAATGACCACCCTGATCTCGAGATCAGGGTGGTCATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-1836s1c1
Sequence:CCGGCGCAGAATGCAAGTGGATAAACTCGAGTTTATCCACTTGCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-2115s1c1
Sequence:CCGGGCGAACTTCCATTCTTTGGATCTCGAGATCCAAAGAATGGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016893
VALIDATED
FUT8 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016893.4-730s21c1
Sequence:CCGGTGGTCATTTGGTTCGAGATAACTCGAGTTATCTCGAACCAAATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-1835s21c1
Sequence:CCGGCGCAGAATGCAAGTGGATAAACTCGAGTTTATCCACTTGCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-2555s21c1
Sequence:CCGGGCCCATACACAGTACAATAATCTCGAGATTATTGTACTGTGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-2114s21c1
Sequence:CCGGGCGAACTTCCATTCTTTGGATCTCGAGATCCAAAGAATGGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-1279s21c1
Sequence:CCGGGCTGGTGTGTAACATCAATAACTCGAGTTATTGATGTTACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-1280s1c1
Sequence:CCGGGCTGGTGTGTAACATCAATAACTCGAGTTATTGATGTTACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-2556s1c1
Sequence:CCGGGCCCATACACAGTACAATAATCTCGAGATTATTGTACTGTGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016893.2-744s1c1
Sequence:CCGGCGAGATAATGACCACCCTGATCTCGAGATCAGGGTGGTCATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-1836s1c1
Sequence:CCGGCGCAGAATGCAAGTGGATAAACTCGAGTTTATCCACTTGCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-2115s1c1
Sequence:CCGGGCGAACTTCCATTCTTTGGATCTCGAGATCCAAAGAATGGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016893
VALIDATED
FUT8 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016893.4-730s21c1
Sequence:CCGGTGGTCATTTGGTTCGAGATAACTCGAGTTATCTCGAACCAAATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-1835s21c1
Sequence:CCGGCGCAGAATGCAAGTGGATAAACTCGAGTTTATCCACTTGCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-2555s21c1
Sequence:CCGGGCCCATACACAGTACAATAATCTCGAGATTATTGTACTGTGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-2114s21c1
Sequence:CCGGGCGAACTTCCATTCTTTGGATCTCGAGATCCAAAGAATGGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016893.4-1279s21c1
Sequence:CCGGGCTGGTGTGTAACATCAATAACTCGAGTTATTGATGTTACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-1280s1c1
Sequence:CCGGGCTGGTGTGTAACATCAATAACTCGAGTTATTGATGTTACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-2556s1c1
Sequence:CCGGGCCCATACACAGTACAATAATCTCGAGATTATTGTACTGTGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016893.2-744s1c1
Sequence:CCGGCGAGATAATGACCACCCTGATCTCGAGATCAGGGTGGTCATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-1836s1c1
Sequence:CCGGCGCAGAATGCAAGTGGATAAACTCGAGTTTATCCACTTGCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016893.2-2115s1c1
Sequence:CCGGGCGAACTTCCATTCTTTGGATCTCGAGATCCAAAGAATGGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004480
VALIDATED
FUT8 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-878s21c1
Sequence:CCGGGTCTATAATGACGGATCTATACTCGAGTATAGATCCGTCATTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-1998s21c1
Sequence:GTACCGGCATTGGGATGGCTATTCTAAACTCGAGTTTAGAATAGCCATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-2327s21c1
Sequence:CCGGTACCCATGCACAGTACAATAACTCGAGTTATTGTACTGTGCATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-1870s21c1
Sequence:CCGGCTTTAGATGACATCTACTATTCTCGAGAATAGTAGATGTCATCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-960s21c1
Sequence:CCGGGAACTGGTTCAGCGGAGAATACTCGAGTATTCTCCGCTGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004480.3-2298s1c1
Sequence:CCGGCCTCTTTAACAAGGGCTGCAACTCGAGTTGCAGCCCTTGTTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004480.3-878s1c1
Sequence:CCGGGTCTATAATGACGGATCTATACTCGAGTATAGATCCGTCATTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004480.3-1615s1c1
Sequence:CCGGCCACAGATGACCCTTCTTTATCTCGAGATAAAGAAGGGTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004480.3-1737s1c1
Sequence:CCGGCGTGGAGTGATCCTGGATATACTCGAGTATATCCAGGATCACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004480.3-1907s1c1
Sequence:CCGGCCACAATCAAATTGCCATTTACTCGAGTAAATGGCAATTTGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004480
VALIDATED
FUT8 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-878s21c1
Sequence:CCGGGTCTATAATGACGGATCTATACTCGAGTATAGATCCGTCATTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-1998s21c1
Sequence:GTACCGGCATTGGGATGGCTATTCTAAACTCGAGTTTAGAATAGCCATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-2327s21c1
Sequence:CCGGTACCCATGCACAGTACAATAACTCGAGTTATTGTACTGTGCATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-1870s21c1
Sequence:CCGGCTTTAGATGACATCTACTATTCTCGAGAATAGTAGATGTCATCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-960s21c1
Sequence:CCGGGAACTGGTTCAGCGGAGAATACTCGAGTATTCTCCGCTGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004480.3-2298s1c1
Sequence:CCGGCCTCTTTAACAAGGGCTGCAACTCGAGTTGCAGCCCTTGTTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004480.3-878s1c1
Sequence:CCGGGTCTATAATGACGGATCTATACTCGAGTATAGATCCGTCATTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004480.3-1615s1c1
Sequence:CCGGCCACAGATGACCCTTCTTTATCTCGAGATAAAGAAGGGTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004480.3-1737s1c1
Sequence:CCGGCGTGGAGTGATCCTGGATATACTCGAGTATATCCAGGATCACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004480.3-1907s1c1
Sequence:CCGGCCACAATCAAATTGCCATTTACTCGAGTAAATGGCAATTTGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004480
VALIDATED
FUT8 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 8 (alpha (1,6) fucosyltransferase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-878s21c1
Sequence:CCGGGTCTATAATGACGGATCTATACTCGAGTATAGATCCGTCATTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-1998s21c1
Sequence:GTACCGGCATTGGGATGGCTATTCTAAACTCGAGTTTAGAATAGCCATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-2327s21c1
Sequence:CCGGTACCCATGCACAGTACAATAACTCGAGTTATTGTACTGTGCATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-1870s21c1
Sequence:CCGGCTTTAGATGACATCTACTATTCTCGAGAATAGTAGATGTCATCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004480.3-960s21c1
Sequence:CCGGGAACTGGTTCAGCGGAGAATACTCGAGTATTCTCCGCTGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004480.3-2298s1c1
Sequence:CCGGCCTCTTTAACAAGGGCTGCAACTCGAGTTGCAGCCCTTGTTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004480.3-878s1c1
Sequence:CCGGGTCTATAATGACGGATCTATACTCGAGTATAGATCCGTCATTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004480.3-1615s1c1
Sequence:CCGGCCACAGATGACCCTTCTTTATCTCGAGATAAAGAAGGGTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004480.3-1737s1c1
Sequence:CCGGCGTGGAGTGATCCTGGATATACTCGAGTATATCCAGGATCACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004480.3-1907s1c1
Sequence:CCGGCCACAATCAAATTGCCATTTACTCGAGTAAATGGCAATTTGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks