EMAIL THIS PAGE TO A FRIEND

FUT9

fucosyltransferase 9 (alpha (1,3) fucosyltransferase)

77 Gene Product Result for
Synonyms: Fuc-TIX
UniProtKB ID: Q9Y231, Q5T0W4
Gene ID:
Human(10690) Summary: The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
Mouse(14348) fucosyltransferase 9
Rat(84597) fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Zebrafish(492813) fucosyltransferase 9
cow(282853) fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Thale Cress(837970) fucosyltransferase 9
dog(449027) fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
chicken(771133) fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006581 Rosetta Predictions human pricing
NM_053465 Rosetta Predictions rat pricing
NM_010243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175990 predicted 1369
2 SASI_Hs02_00341873 predicted 863
3 SASI_Hs01_00175991 predicted 892
4 SASI_Hs01_00175992 predicted 801
5 SASI_Hs01_00175993 predicted 772
6 SASI_Hs01_00175995 predicted 1467
7 SASI_Hs01_00175997 predicted 525
8 SASI_Hs02_00341874 predicted 723
9 SASI_Hs01_00175998 predicted 673
10 SASI_Hs01_00175999 predicted 573
11 SASI_Hs01_00175994 predicted 1021
12 SASI_Hs01_00175996 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116273 predicted 344
2 SASI_Rn01_00116274 predicted 896
3 SASI_Rn01_00116275 predicted 986
4 SASI_Rn01_00116276 predicted 1168
5 SASI_Rn01_00116278 predicted 535
6 SASI_Rn01_00116279 predicted 389
7 SASI_Rn01_00116280 predicted 1192
8 SASI_Rn01_00116281 predicted 1380
9 SASI_Rn01_00116282 predicted 1009
10 SASI_Rn02_00266049 predicted 975
11 SASI_Rn01_00116277 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042486 predicted 1579
2 SASI_Mm01_00042487 predicted 700
3 SASI_Mm01_00042488 predicted 1443
4 SASI_Mm01_00042489 predicted 737
5 SASI_Mm01_00042490 predicted 959
6 SASI_Mm01_00042491 predicted 1029
7 SASI_Mm01_00042493 predicted 1033
8 SASI_Mm01_00042494 predicted 1008
9 SASI_Mm01_00042495 predicted 1348
10 SASI_Mm02_00318115 predicted 1144
11 SASI_Mm01_00042492 predicted 901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006581
VALIDATED
FUT9 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006581.2-2509s1c1
Sequence:CCGGGCACATTTGTTGGATGAATAACTCGAGTTATTCATCCAACAAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-551s1c1
Sequence:CCGGCCTTACATCCTGCCAAGCAATCTCGAGATTGCTTGGCAGGATGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006581.2-1161s1c1
Sequence:CCGGCCAGCAGATTCATTCATTCATCTCGAGATGAATGAATGAATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-1014s1c1
Sequence:CCGGCCTACCATATCTGCTTGTAAACTCGAGTTTACAAGCAGATATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-918s1c1
Sequence:CCGGGCCAGAGTCAAGTATTACAATCTCGAGATTGTAATACTTGACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-680s21c1
Sequence:CCGGCAGTTGGGATCTGACAAATTTCTCGAGAAATTTGTCAGATCCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006581.3-10832s21c1
Sequence:CCGGGCAGACCCAATAGGGTTATTTCTCGAGAAATAACCCTATTGGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-628s21c1
Sequence:GTACCGGACCGTTCACTGTACAACAAATCTCGAGATTTGTTGTACAGTGAACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006581.3-806s21c1
Sequence:CCGGTCTGACTTACCGCCGTGATTCCTCGAGGAATCACGGCGGTAAGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-938s21c1
Sequence:CCGGGCATGCCAGAGTCAAGTATTACTCGAGTAATACTTGACTCTGGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006581
VALIDATED
FUT9 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006581.2-2509s1c1
Sequence:CCGGGCACATTTGTTGGATGAATAACTCGAGTTATTCATCCAACAAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-551s1c1
Sequence:CCGGCCTTACATCCTGCCAAGCAATCTCGAGATTGCTTGGCAGGATGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006581.2-1161s1c1
Sequence:CCGGCCAGCAGATTCATTCATTCATCTCGAGATGAATGAATGAATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-1014s1c1
Sequence:CCGGCCTACCATATCTGCTTGTAAACTCGAGTTTACAAGCAGATATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-918s1c1
Sequence:CCGGGCCAGAGTCAAGTATTACAATCTCGAGATTGTAATACTTGACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-680s21c1
Sequence:CCGGCAGTTGGGATCTGACAAATTTCTCGAGAAATTTGTCAGATCCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006581.3-10832s21c1
Sequence:CCGGGCAGACCCAATAGGGTTATTTCTCGAGAAATAACCCTATTGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-628s21c1
Sequence:GTACCGGACCGTTCACTGTACAACAAATCTCGAGATTTGTTGTACAGTGAACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006581.3-806s21c1
Sequence:CCGGTCTGACTTACCGCCGTGATTCCTCGAGGAATCACGGCGGTAAGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-938s21c1
Sequence:CCGGGCATGCCAGAGTCAAGTATTACTCGAGTAATACTTGACTCTGGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006581
VALIDATED
FUT9 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006581.2-2509s1c1
Sequence:CCGGGCACATTTGTTGGATGAATAACTCGAGTTATTCATCCAACAAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-551s1c1
Sequence:CCGGCCTTACATCCTGCCAAGCAATCTCGAGATTGCTTGGCAGGATGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006581.2-1161s1c1
Sequence:CCGGCCAGCAGATTCATTCATTCATCTCGAGATGAATGAATGAATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-1014s1c1
Sequence:CCGGCCTACCATATCTGCTTGTAAACTCGAGTTTACAAGCAGATATGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006581.2-918s1c1
Sequence:CCGGGCCAGAGTCAAGTATTACAATCTCGAGATTGTAATACTTGACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-680s21c1
Sequence:CCGGCAGTTGGGATCTGACAAATTTCTCGAGAAATTTGTCAGATCCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006581.3-10832s21c1
Sequence:CCGGGCAGACCCAATAGGGTTATTTCTCGAGAAATAACCCTATTGGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-628s21c1
Sequence:GTACCGGACCGTTCACTGTACAACAAATCTCGAGATTTGTTGTACAGTGAACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006581.3-806s21c1
Sequence:CCGGTCTGACTTACCGCCGTGATTCCTCGAGGAATCACGGCGGTAAGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006581.3-938s21c1
Sequence:CCGGGCATGCCAGAGTCAAGTATTACTCGAGTAATACTTGACTCTGGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010243
FUT9 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010243.2-2240s1c1
Sequence:CCGGCGCTAGTTACTTCATTCATTTCTCGAGAAATGAATGAAGTAACTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-685s1c1
Sequence:CCGGCCACCCTTTCAGAAATGGATTCTCGAGAATCCATTTCTGAAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-551s1c1
Sequence:CCGGCCTGCCAAGCAATGTTCAATACTCGAGTATTGAACATTGCTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-933s1c1
Sequence:CCGGGCTCAGCAAGAGTATTGAAATCTCGAGATTTCAATACTCTTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-339s1c1
Sequence:CCGGCCCATTTCTAATCGTCTGCATCTCGAGATGCAGACGATTAGAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010243
FUT9 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010243.2-2240s1c1
Sequence:CCGGCGCTAGTTACTTCATTCATTTCTCGAGAAATGAATGAAGTAACTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-685s1c1
Sequence:CCGGCCACCCTTTCAGAAATGGATTCTCGAGAATCCATTTCTGAAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-551s1c1
Sequence:CCGGCCTGCCAAGCAATGTTCAATACTCGAGTATTGAACATTGCTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-933s1c1
Sequence:CCGGGCTCAGCAAGAGTATTGAAATCTCGAGATTTCAATACTCTTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-339s1c1
Sequence:CCGGCCCATTTCTAATCGTCTGCATCTCGAGATGCAGACGATTAGAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010243
FUT9 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 9 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010243.2-2240s1c1
Sequence:CCGGCGCTAGTTACTTCATTCATTTCTCGAGAAATGAATGAAGTAACTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-685s1c1
Sequence:CCGGCCACCCTTTCAGAAATGGATTCTCGAGAATCCATTTCTGAAAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-551s1c1
Sequence:CCGGCCTGCCAAGCAATGTTCAATACTCGAGTATTGAACATTGCTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-933s1c1
Sequence:CCGGGCTCAGCAAGAGTATTGAAATCTCGAGATTTCAATACTCTTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010243.2-339s1c1
Sequence:CCGGCCCATTTCTAATCGTCTGCATCTCGAGATGCAGACGATTAGAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)