EMAIL THIS PAGE TO A FRIEND

FUZ

fuzzy planar cell polarity protein

74 Gene Product Result for
Synonyms: FY NTD
UniProtKB ID: Q9BT04, B2RD86, B5MDH0, Q6PJY0, Q9H613
Gene ID:
Human(80199) Summary: This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(70300) fuzzy homolog (Drosophila)
Rat(308577) fuzzy planar cell polarity protein
Zebrafish(100302104) fuzzy homolog
cow(528818) fuzzy homolog (Drosophila)
domestic cat(101094308) fuzzy homolog (Drosophila)
dog(476409) fuzzy homolog (Drosophila)
sheep(101108852) fuzzy homolog (Drosophila)
domestic guinea pig(100722606) fuzzy planar cell polarity protein
naked mole-rat(101716481) fuzzy planar cell polarity protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025129 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025129 Rosetta Predictions human pricing
NM_001037646 Rosetta Predictions rat pricing
NM_027376 Rosetta Predictions mouse pricing
XM_133445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111854 predicted 550
2 SASI_Hs02_00357837 predicted 260
3 SASI_Hs02_00357838 predicted 446
4 SASI_Hs01_00111855 predicted 246
5 SASI_Hs01_00111856 predicted 493
6 SASI_Hs01_00111857 predicted 479
7 SASI_Hs01_00111859 predicted 866
8 SASI_Hs01_00111860 predicted 481
9 SASI_Hs01_00111861 predicted 413
10 SASI_Hs01_00111862 predicted 214
11 SASI_Hs01_00111858 predicted 295
12 SASI_Hs01_00111863 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116193 predicted 811
2 SASI_Rn01_00116194 predicted 630
3 SASI_Rn01_00116195 predicted 292
4 SASI_Rn01_00116196 predicted 923
5 SASI_Rn01_00116197 predicted 482
6 SASI_Rn01_00116198 predicted 819
7 SASI_Rn01_00116199 predicted 278
8 SASI_Rn01_00116200 predicted 1017
9 SASI_Rn01_00116201 predicted 487
10 SASI_Rn01_00116202 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332074 predicted 865
2 SASI_Mm02_00332075 predicted 404
3 SASI_Mm02_00332076 predicted 374
4 SASI_Mm02_00332077 predicted 327
5 SASI_Mm02_00332078 predicted 523
6 SASI_Mm02_00332079 predicted 307
7 SASI_Mm02_00332080 predicted 695
8 SASI_Mm02_00332081 predicted 824
9 SASI_Mm02_00332082 predicted 1067
10 SASI_Mm02_00332083 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234742 predicted 290
2 SASI_Mm01_00234743 predicted 255
3 SASI_Mm01_00234744 predicted 281
4 SASI_Mm01_00234745 predicted 385
5 SASI_Mm01_00234746 predicted 388
6 SASI_Mm01_00234747 predicted 268
7 SASI_Mm01_00234748 predicted 301
8 SASI_Mm01_00234749 predicted 278
9 SASI_Mm01_00234750 predicted 272
10 SASI_Mm01_00234751 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025129
FUZ MISSION shRNA Bacterial Glycerol Stock
fuzzy planar cell polarity protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025129.4-537s21c1
Sequence:CCGGACTTGAAGAACTGACCAATATCTCGAGATATTGGTCAGTTCTTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025129.4-493s21c1
Sequence:CCGGAGACTACTCCAAATGGTGTTTCTCGAGAAACACCATTTGGAGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-334s1c1
Sequence:CCGGGACAGCATCACCCTCATTGTTCTCGAGAACAATGAGGGTGATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-1057s1c1
Sequence:CCGGGATAAAGAGCCTTCACCAGAACTCGAGTTCTGGTGAAGGCTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-462s1c1
Sequence:CCGGCAACGTGGAGAGACTGAAGAACTCGAGTTCTTCAGTCTCTCCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-1155s1c1
Sequence:CCGGGAAGACAGAAGATGAGGTCTACTCGAGTAGACCTCATCTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-241s1c1
Sequence:CCGGCTCAATGGAGTCCACATGTTTCTCGAGAAACATGTGGACTCCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025129
FUZ MISSION shRNA shRNA Plasmid DNA
fuzzy planar cell polarity protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025129.4-537s21c1
Sequence:CCGGACTTGAAGAACTGACCAATATCTCGAGATATTGGTCAGTTCTTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025129.4-493s21c1
Sequence:CCGGAGACTACTCCAAATGGTGTTTCTCGAGAAACACCATTTGGAGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-334s1c1
Sequence:CCGGGACAGCATCACCCTCATTGTTCTCGAGAACAATGAGGGTGATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-1057s1c1
Sequence:CCGGGATAAAGAGCCTTCACCAGAACTCGAGTTCTGGTGAAGGCTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-462s1c1
Sequence:CCGGCAACGTGGAGAGACTGAAGAACTCGAGTTCTTCAGTCTCTCCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-1155s1c1
Sequence:CCGGGAAGACAGAAGATGAGGTCTACTCGAGTAGACCTCATCTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-241s1c1
Sequence:CCGGCTCAATGGAGTCCACATGTTTCTCGAGAAACATGTGGACTCCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025129
FUZ MISSION shRNA Lentiviral Transduction Particles
fuzzy planar cell polarity protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025129.4-537s21c1
Sequence:CCGGACTTGAAGAACTGACCAATATCTCGAGATATTGGTCAGTTCTTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025129.4-493s21c1
Sequence:CCGGAGACTACTCCAAATGGTGTTTCTCGAGAAACACCATTTGGAGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-334s1c1
Sequence:CCGGGACAGCATCACCCTCATTGTTCTCGAGAACAATGAGGGTGATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-1057s1c1
Sequence:CCGGGATAAAGAGCCTTCACCAGAACTCGAGTTCTGGTGAAGGCTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-462s1c1
Sequence:CCGGCAACGTGGAGAGACTGAAGAACTCGAGTTCTTCAGTCTCTCCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-1155s1c1
Sequence:CCGGGAAGACAGAAGATGAGGTCTACTCGAGTAGACCTCATCTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025129.3-241s1c1
Sequence:CCGGCTCAATGGAGTCCACATGTTTCTCGAGAAACATGTGGACTCCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027376
FUZ MISSION shRNA Bacterial Glycerol Stock
fuzzy planar cell polarity protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-1041s21c1
Sequence:CCGGTTCCCACTACACAGCGATATTCTCGAGAATATCGCTGTGTAGTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-1092s21c1
Sequence:CCGGCGACGCTGCCTCTTTACTATGCTCGAGCATAGTAAAGAGGCAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-400s21c1
Sequence:CCGGATGACAGTATCACTCTCATTGCTCGAGCAATGAGAGTGATACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-505s21c1
Sequence:CCGGGACTTGAGGAGCTGACCAATACTCGAGTATTGGTCAGCTCCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027376.2-1424s21c1
Sequence:CCGGACTCAGGGTGGGCAGTCAATACTCGAGTATTGACTGCCCACCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027376
FUZ MISSION shRNA shRNA Plasmid DNA
fuzzy planar cell polarity protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-1041s21c1
Sequence:CCGGTTCCCACTACACAGCGATATTCTCGAGAATATCGCTGTGTAGTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-1092s21c1
Sequence:CCGGCGACGCTGCCTCTTTACTATGCTCGAGCATAGTAAAGAGGCAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-400s21c1
Sequence:CCGGATGACAGTATCACTCTCATTGCTCGAGCAATGAGAGTGATACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-505s21c1
Sequence:CCGGGACTTGAGGAGCTGACCAATACTCGAGTATTGGTCAGCTCCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027376.2-1424s21c1
Sequence:CCGGACTCAGGGTGGGCAGTCAATACTCGAGTATTGACTGCCCACCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027376
FUZ MISSION shRNA Lentiviral Transduction Particles
fuzzy planar cell polarity protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-1041s21c1
Sequence:CCGGTTCCCACTACACAGCGATATTCTCGAGAATATCGCTGTGTAGTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-1092s21c1
Sequence:CCGGCGACGCTGCCTCTTTACTATGCTCGAGCATAGTAAAGAGGCAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-400s21c1
Sequence:CCGGATGACAGTATCACTCTCATTGCTCGAGCAATGAGAGTGATACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027376.2-505s21c1
Sequence:CCGGGACTTGAGGAGCTGACCAATACTCGAGTATTGGTCAGCTCCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027376.2-1424s21c1
Sequence:CCGGACTCAGGGTGGGCAGTCAATACTCGAGTATTGACTGCCCACCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks