EMAIL THIS PAGE TO A FRIEND

FXN

frataxin

112 Gene Product Result for
Synonyms: CyaY FA FARR FRDA X25
Gene ID:
Human(2395) Summary: This nuclear gene encodes a mitochondrial protein which belongs to FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA results in Friedreich ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Mouse(14297) frataxin
Rat(499335) frataxin
cow(505694) frataxin
dog(609051) frataxin
chicken(427244) frataxin
sheep(101107413) frataxin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054361 MISSION® esiRNA esiRNA human FXN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000144 Rosetta Predictions human pricing
NM_181425 Rosetta Predictions human pricing
XM_001078791 Rosetta Predictions rat pricing
XM_574642 Rosetta Predictions rat pricing
NM_008044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088108 predicted 1403
2 SASI_Hs01_00088109 predicted 1451
3 SASI_Hs01_00088112 predicted 521
4 SASI_Hs01_00088113 predicted 1347
5 SASI_Hs01_00088115 predicted 527
6 SASI_Hs01_00088116 predicted 1425
7 SASI_Hs02_00301959 predicted 1353
8 SASI_Hs01_00088110 predicted 528
9 SASI_Hs01_00088114 predicted 1328
10 SASI_Hs01_00088117 predicted 568
11 SASI_Hs01_00088111 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224263 predicted 524
2 SASI_Hs01_00224272 predicted 1433
3 SASI_Hs01_00224264 predicted 1334
4 SASI_Hs01_00224266 predicted 745
5 SASI_Hs01_00224267 predicted 700
6 SASI_Hs02_00370031 predicted 702
7 SASI_Hs02_00370032 predicted 815
8 SASI_Hs02_00370033 predicted 1217
9 SASI_Hs02_00370034 predicted 704
10 SASI_Hs02_00370035 predicted 754
11 SASI_Hs01_00224265 predicted 1271
12 SASI_Hs01_00224268 predicted 707
13 SASI_Hs01_00224269 predicted 776
14 SASI_Hs01_00224270 predicted 715
15 SASI_Hs01_00224271 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361983 predicted 520
2 SASI_Rn02_00361984 predicted 219
3 SASI_Rn02_00361985 predicted 538
4 SASI_Rn02_00361986 predicted 385
5 SASI_Rn02_00361987 predicted 429
6 SASI_Rn02_00361988 predicted 457
7 SASI_Rn02_00361989 predicted 477
8 SASI_Rn02_00361990 predicted 527
9 SASI_Rn02_00361991 predicted 600
10 SASI_Rn02_00361992 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402310 predicted 352
2 SASI_Rn02_00402311 predicted 411
3 SASI_Rn02_00402312 predicted 487
4 SASI_Rn02_00402313 predicted 496
5 SASI_Rn02_00402314 predicted 353
6 SASI_Rn02_00402315 predicted 390
7 SASI_Rn02_00402316 predicted 479
8 SASI_Rn02_00402317 predicted 266
9 SASI_Rn02_00402318 predicted 518
10 SASI_Rn02_00402319 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138051 predicted 720
2 SASI_Mm02_00313001 predicted 748
3 SASI_Mm01_00138054 predicted 650
4 SASI_Mm02_00313002 predicted 645
5 SASI_Mm02_00313003 predicted 708
6 SASI_Mm02_00313004 predicted 807
7 SASI_Mm02_00313005 predicted 703
8 SASI_Mm01_00138058 predicted 280
9 SASI_Mm02_00313006 predicted 279
10 SASI_Mm02_00313007 predicted 771
11 SASI_Mm01_00138052 predicted 432
12 SASI_Mm01_00138053 predicted 500
13 SASI_Mm01_00138055 predicted 585
14 SASI_Mm01_00138056 predicted 516
15 SASI_Mm01_00138057 predicted 602
16 SASI_Mm01_00138059 predicted 422
17 SASI_Mm01_00138060 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000144
VALIDATED
FXN MISSION shRNA Bacterial Glycerol Stock
frataxin
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-704s1c1
Sequence:CCGGCCATACACGTTTGAGGACTATCTCGAGATAGTCCTCAAACGTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000144.3-1922s1c1
Sequence:CCGGCCCATCTGTTAAATGAGAGAACTCGAGTTCTCTCATTTAACAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-796s1c1
Sequence:CCGGGCAGACGCCAAACAAGCAAATCTCGAGATTTGCTTGTTTGGCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000144.3-541s1c1
Sequence:CCGGCAACCAGATTTGGAATGTCAACTCGAGTTGACATTCCAAATCTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-661s1c1
Sequence:CCGGGCTGGACTCTTTAGCAGAGTTCTCGAGAACTCTGCTAAAGAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.4-397s21c1
Sequence:CCGGACGTGGCCTCAACCAGATTTGCTCGAGCAAATCTGGTTGAGGCCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000144.3-1428s21c1
Sequence:CCGGATTAAAGGGTAGCCTACAAATCTCGAGATTTGTAGGCTACCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-834s21c1
Sequence:CCGGCCAGTGGACCTAAGCGTTATGCTCGAGCATAACGCTTAGGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-704s21c1
Sequence:CCGGCCATACACGTTTGAGGACTATCTCGAGATAGTCCTCAAACGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-796s21c1
Sequence:CCGGGCAGACGCCAAACAAGCAAATCTCGAGATTTGCTTGTTTGGCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-661s21c1
Sequence:CCGGGCTGGACTCTTTAGCAGAGTTCTCGAGAACTCTGCTAAAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.4-597s21c1
Sequence:CCGGCCTTTGGGAGTGGTGTCTTAACTCGAGTTAAGACACCACTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000144
VALIDATED
FXN MISSION shRNA shRNA Plasmid DNA
frataxin
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-704s1c1
Sequence:CCGGCCATACACGTTTGAGGACTATCTCGAGATAGTCCTCAAACGTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000144.3-1922s1c1
Sequence:CCGGCCCATCTGTTAAATGAGAGAACTCGAGTTCTCTCATTTAACAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-796s1c1
Sequence:CCGGGCAGACGCCAAACAAGCAAATCTCGAGATTTGCTTGTTTGGCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000144.3-541s1c1
Sequence:CCGGCAACCAGATTTGGAATGTCAACTCGAGTTGACATTCCAAATCTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-661s1c1
Sequence:CCGGGCTGGACTCTTTAGCAGAGTTCTCGAGAACTCTGCTAAAGAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.4-397s21c1
Sequence:CCGGACGTGGCCTCAACCAGATTTGCTCGAGCAAATCTGGTTGAGGCCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000144.3-1428s21c1
Sequence:CCGGATTAAAGGGTAGCCTACAAATCTCGAGATTTGTAGGCTACCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-834s21c1
Sequence:CCGGCCAGTGGACCTAAGCGTTATGCTCGAGCATAACGCTTAGGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-704s21c1
Sequence:CCGGCCATACACGTTTGAGGACTATCTCGAGATAGTCCTCAAACGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-796s21c1
Sequence:CCGGGCAGACGCCAAACAAGCAAATCTCGAGATTTGCTTGTTTGGCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-661s21c1
Sequence:CCGGGCTGGACTCTTTAGCAGAGTTCTCGAGAACTCTGCTAAAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.4-597s21c1
Sequence:CCGGCCTTTGGGAGTGGTGTCTTAACTCGAGTTAAGACACCACTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000144
VALIDATED
FXN MISSION shRNA Lentiviral Transduction Particles
frataxin
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-704s1c1
Sequence:CCGGCCATACACGTTTGAGGACTATCTCGAGATAGTCCTCAAACGTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000144.3-1922s1c1
Sequence:CCGGCCCATCTGTTAAATGAGAGAACTCGAGTTCTCTCATTTAACAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-796s1c1
Sequence:CCGGGCAGACGCCAAACAAGCAAATCTCGAGATTTGCTTGTTTGGCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000144.3-541s1c1
Sequence:CCGGCAACCAGATTTGGAATGTCAACTCGAGTTGACATTCCAAATCTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000144.3-661s1c1
Sequence:CCGGGCTGGACTCTTTAGCAGAGTTCTCGAGAACTCTGCTAAAGAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.4-397s21c1
Sequence:CCGGACGTGGCCTCAACCAGATTTGCTCGAGCAAATCTGGTTGAGGCCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000144.3-1428s21c1
Sequence:CCGGATTAAAGGGTAGCCTACAAATCTCGAGATTTGTAGGCTACCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-834s21c1
Sequence:CCGGCCAGTGGACCTAAGCGTTATGCTCGAGCATAACGCTTAGGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-704s21c1
Sequence:CCGGCCATACACGTTTGAGGACTATCTCGAGATAGTCCTCAAACGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-796s21c1
Sequence:CCGGGCAGACGCCAAACAAGCAAATCTCGAGATTTGCTTGTTTGGCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.3-661s21c1
Sequence:CCGGGCTGGACTCTTTAGCAGAGTTCTCGAGAACTCTGCTAAAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000144.4-597s21c1
Sequence:CCGGCCTTTGGGAGTGGTGTCTTAACTCGAGTTAAGACACCACTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008044
VALIDATED
FXN MISSION shRNA Bacterial Glycerol Stock
frataxin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008044.1-334s1c1
Sequence:CCGGGAGTTCTTTGAAGACCTCGCACTCGAGTGCGAGGTCTTCAAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008044.1-600s1c1
Sequence:CCGGCAAACTGGACTTGTCTTCATTCTCGAGAATGAAGACAAGTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008044.1-810s1c1
Sequence:CCGGGCTCTTCATTTCTACAGACATCTCGAGATGTCTGTAGAAATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008044.1-198s1c1
Sequence:CCGGCCTCCAGATTCTGAACATCAACTCGAGTTGATGTTCAGAATCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008044.1-607s1c1
Sequence:CCGGGACTTGTCTTCATTGGCCTATCTCGAGATAGGCCAATGAAGACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008044
VALIDATED
FXN MISSION shRNA shRNA Plasmid DNA
frataxin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008044.1-334s1c1
Sequence:CCGGGAGTTCTTTGAAGACCTCGCACTCGAGTGCGAGGTCTTCAAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008044.1-600s1c1
Sequence:CCGGCAAACTGGACTTGTCTTCATTCTCGAGAATGAAGACAAGTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008044.1-810s1c1
Sequence:CCGGGCTCTTCATTTCTACAGACATCTCGAGATGTCTGTAGAAATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008044.1-198s1c1
Sequence:CCGGCCTCCAGATTCTGAACATCAACTCGAGTTGATGTTCAGAATCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008044.1-607s1c1
Sequence:CCGGGACTTGTCTTCATTGGCCTATCTCGAGATAGGCCAATGAAGACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008044
VALIDATED
FXN MISSION shRNA Lentiviral Transduction Particles
frataxin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008044.1-334s1c1
Sequence:CCGGGAGTTCTTTGAAGACCTCGCACTCGAGTGCGAGGTCTTCAAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008044.1-600s1c1
Sequence:CCGGCAAACTGGACTTGTCTTCATTCTCGAGAATGAAGACAAGTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008044.1-810s1c1
Sequence:CCGGGCTCTTCATTTCTACAGACATCTCGAGATGTCTGTAGAAATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008044.1-198s1c1
Sequence:CCGGCCTCCAGATTCTGAACATCAACTCGAGTTGATGTTCAGAATCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008044.1-607s1c1
Sequence:CCGGGACTTGTCTTCATTGGCCTATCTCGAGATAGGCCAATGAAGACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks