EMAIL THIS PAGE TO A FRIEND

FXR1

fragile X mental retardation, autosomal homolog 1

209 Gene Product Result for
Synonyms: FXR1P
UniProtKB ID: P51114, A8K9B8, Q7Z450, Q8N6R8
Gene ID:
Human(8087) Summary: The protein encoded by this gene is an RNA binding protein that interacts with the functionally-similar proteins FMR1 and FXR2. These proteins shuttle between the nucleus and cytoplasm and associate with polyribosomes, predominantly with the 60S ribosomal subunit. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14359) fragile X mental retardation gene 1, autosomal homolog
Rat(361927) fragile X mental retardation, autosomal homolog 1
Zebrafish(327220) fragile X mental retardation, autosomal homolog 1
cow(536793) fragile X mental retardation, autosomal homolog 1
Horse(100066076) fragile X mental retardation, autosomal homolog 1
chicken(424968) fragile X mental retardation, autosomal homolog 1
domestic cat(101093590) fragile X mental retardation, autosomal homolog 1
dog(478642) fragile X mental retardation, autosomal homolog 1
sheep(101104706) fragile X mental retardation, autosomal homolog 1
Domestic Rabbit(100340080) fragile X mental retardation, autosomal homolog 1
naked mole-rat(101721153) fragile X mental retardation, autosomal homolog 1
domestic guinea pig(100714193) fragile X mental retardation, autosomal homolog 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005087 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013438 Rosetta Predictions human pricing
NM_001013439 Rosetta Predictions human pricing
NM_005087 Rosetta Predictions human pricing
NM_001012179 Rosetta Predictions rat pricing
XM_578009 Rosetta Predictions rat pricing
NM_001113188 Rosetta Predictions mouse pricing
NM_001113189 Rosetta Predictions mouse pricing
NM_008053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071083 predicted 1073
2 SASI_Hs01_00071084 predicted 1106
3 SASI_Hs01_00071085 predicted 700
4 SASI_Hs01_00071086 predicted 1192
5 SASI_Hs01_00071087 predicted 767
6 SASI_Hs01_00071088 predicted 786
7 SASI_Hs01_00071089 predicted 1212
8 SASI_Hs01_00071090 predicted 847
9 SASI_Hs01_00071091 predicted 1259
10 SASI_Hs02_00306376 predicted 1393
11 SASI_Hs01_00071092 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120492 predicted 1419
2 SASI_Hs01_00120493 predicted 1455
3 SASI_Hs01_00120494 predicted 1039
4 SASI_Hs01_00120495 predicted 1534
5 SASI_Hs01_00120496 predicted 1103
6 SASI_Hs01_00120497 predicted 1133
7 SASI_Hs01_00120498 predicted 1555
8 SASI_Hs01_00120499 predicted 1183
9 SASI_Hs01_00120500 predicted 1604
10 SASI_Hs02_00306377 predicted 1737
11 SASI_Hs01_00120501 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157051 predicted 1076
2 SASI_Hs01_00157052 predicted 1110
3 SASI_Hs01_00157053 predicted 694
4 SASI_Hs01_00157054 predicted 1196
5 SASI_Hs01_00157055 predicted 759
6 SASI_Hs01_00157056 predicted 782
7 SASI_Hs01_00157057 predicted 1214
8 SASI_Hs01_00157058 predicted 846
9 SASI_Hs01_00157059 predicted 1265
10 SASI_Hs02_00338936 predicted 1394
11 SASI_Hs01_00157060 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110041 predicted 1643
2 SASI_Rn01_00110042 predicted 1333
3 SASI_Rn01_00110044 predicted 1272
4 SASI_Rn01_00110045 predicted 1700
5 SASI_Rn01_00110046 predicted 787
6 SASI_Rn02_00200382 predicted 1735
7 SASI_Rn02_00200383 predicted 681
8 SASI_Rn01_00110048 predicted 1291
9 SASI_Rn02_00200384 predicted 1522
10 SASI_Rn01_00110049 predicted 1514
11 SASI_Rn01_00110040 predicted 930
12 SASI_Rn01_00110043 predicted 1047
13 SASI_Rn01_00110047 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172990 predicted 887
2 SASI_Rn01_00172991 predicted 892
3 SASI_Rn01_00172992 predicted 898
4 SASI_Rn01_00172993 predicted 894
5 SASI_Rn01_00172994 predicted 1815
6 SASI_Rn01_00172995 predicted 2256
7 SASI_Rn01_00172996 predicted 1125
8 SASI_Rn01_00172997 predicted 315
9 SASI_Rn01_00172998 predicted 883
10 SASI_Rn01_00172999 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307183 predicted 813
2 SASI_Mm02_00307184 predicted 726
3 SASI_Mm02_00307185 predicted 760
4 SASI_Mm02_00307186 predicted 736
5 SASI_Mm02_00307187 predicted 797
6 SASI_Mm02_00307188 predicted 737
7 SASI_Mm02_00307189 predicted 858
8 SASI_Mm02_00307190 predicted 809
9 SASI_Mm02_00307191 predicted 939
10 SASI_Mm02_00307192 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307193 predicted 815
2 SASI_Mm02_00307194 predicted 730
3 SASI_Mm02_00307195 predicted 761
4 SASI_Mm02_00307196 predicted 728
5 SASI_Mm02_00307197 predicted 794
6 SASI_Mm02_00307198 predicted 743
7 SASI_Mm02_00307199 predicted 852
8 SASI_Mm02_00307200 predicted 805
9 SASI_Mm02_00307201 predicted 938
10 SASI_Mm02_00307202 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313023 predicted 807
2 SASI_Mm02_00313024 predicted 727
3 SASI_Mm02_00313025 predicted 756
4 SASI_Mm02_00313026 predicted 735
5 SASI_Mm01_00094323 predicted 795
6 SASI_Mm02_00313027 predicted 744
7 SASI_Mm02_00313028 predicted 860
8 SASI_Mm02_00313029 predicted 802
9 SASI_Mm02_00313030 predicted 937
10 SASI_Mm02_00313031 predicted 929
11 SASI_Mm01_00094322 predicted 1545
12 SASI_Mm01_00094324 predicted 1262
13 SASI_Mm01_00094325 predicted 1188
14 SASI_Mm01_00094326 predicted 1049
15 SASI_Mm01_00094327 predicted 1661
16 SASI_Mm01_00094328 predicted 1444
17 SASI_Mm01_00094329 predicted 1213
18 SASI_Mm01_00094330 predicted 1010
19 SASI_Mm01_00094331 predicted 1624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005087
VALIDATED
FXR1 MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation, autosomal homolog 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1078s21c1
Sequence:CCGGGTATCATATTGCCTATCTAAACTCGAGTTTAGATAGGCAATATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1152s21c1
Sequence:CCGGAGATTGGTTCTAGGTCTTATACTCGAGTATAAGACCTAGAACCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005087.2-2199s21c1
Sequence:CCGGTGGGATCCCTAACGTAATATTCTCGAGAATATTACGTTAGGGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1208s21c1
Sequence:CCGGACCTCCGGTTATGGTACAAATCTCGAGATTTGTACCATAACCGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-611s1c1
Sequence:CCGGCCAGAAATGAAGAGGCCACTACTCGAGTAGTGGCCTCTTCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1531s1c1
Sequence:CCGGCGTAGACGAAGGACTGATGAACTCGAGTTCATCAGTCCTTCGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-425s1c1
Sequence:CCGGGAGAGGCGTGTGCTAATGAAACTCGAGTTTCATTAGCACACGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-835s1c1
Sequence:CCGGGCTAGAGGTTTCTTGGAATTTCTCGAGAAATTCCAAGAAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-1028s1c1
Sequence:CCGGGCACTAAAGAAAGCATTGGAACTCGAGTTCCAATGCTTTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-310s1c1
Sequence:CCGGGACGCTACTTACAATGAAATACTCGAGTATTTCATTGTAAGTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005087.1-256s1c1
Sequence:CCGGGCTAAAGTTCGGATGATGAAACTCGAGTTTCATCATCCGAACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-130s1c1
Sequence:CCGGCGCCAGGTTCCATTTAATGAACTCGAGTTCATTAAATGGAACCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-579s1c1
Sequence:CCGGGCGAAGTATTCGTACGAAGTTCTCGAGAACTTCGTACGAATACTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1240s1c1
Sequence:CCGGGAAACGGAATCTGAGCGTAAACTCGAGTTTACGCTCAGATTCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-1490s1c1
Sequence:CCGGCCAGCGAATCTCATCACAGTACTCGAGTACTGTGATGAGATTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1671s1c1
Sequence:CCGGCCCAAGGGAAACTTTGGCTAACTCGAGTTAGCCAAAGTTTCCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005087
VALIDATED
FXR1 MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation, autosomal homolog 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1078s21c1
Sequence:CCGGGTATCATATTGCCTATCTAAACTCGAGTTTAGATAGGCAATATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1152s21c1
Sequence:CCGGAGATTGGTTCTAGGTCTTATACTCGAGTATAAGACCTAGAACCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005087.2-2199s21c1
Sequence:CCGGTGGGATCCCTAACGTAATATTCTCGAGAATATTACGTTAGGGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1208s21c1
Sequence:CCGGACCTCCGGTTATGGTACAAATCTCGAGATTTGTACCATAACCGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-611s1c1
Sequence:CCGGCCAGAAATGAAGAGGCCACTACTCGAGTAGTGGCCTCTTCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1531s1c1
Sequence:CCGGCGTAGACGAAGGACTGATGAACTCGAGTTCATCAGTCCTTCGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-425s1c1
Sequence:CCGGGAGAGGCGTGTGCTAATGAAACTCGAGTTTCATTAGCACACGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-835s1c1
Sequence:CCGGGCTAGAGGTTTCTTGGAATTTCTCGAGAAATTCCAAGAAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-1028s1c1
Sequence:CCGGGCACTAAAGAAAGCATTGGAACTCGAGTTCCAATGCTTTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-310s1c1
Sequence:CCGGGACGCTACTTACAATGAAATACTCGAGTATTTCATTGTAAGTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005087.1-256s1c1
Sequence:CCGGGCTAAAGTTCGGATGATGAAACTCGAGTTTCATCATCCGAACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-130s1c1
Sequence:CCGGCGCCAGGTTCCATTTAATGAACTCGAGTTCATTAAATGGAACCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-579s1c1
Sequence:CCGGGCGAAGTATTCGTACGAAGTTCTCGAGAACTTCGTACGAATACTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1240s1c1
Sequence:CCGGGAAACGGAATCTGAGCGTAAACTCGAGTTTACGCTCAGATTCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-1490s1c1
Sequence:CCGGCCAGCGAATCTCATCACAGTACTCGAGTACTGTGATGAGATTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1671s1c1
Sequence:CCGGCCCAAGGGAAACTTTGGCTAACTCGAGTTAGCCAAAGTTTCCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005087
VALIDATED
FXR1 MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation, autosomal homolog 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1078s21c1
Sequence:CCGGGTATCATATTGCCTATCTAAACTCGAGTTTAGATAGGCAATATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1152s21c1
Sequence:CCGGAGATTGGTTCTAGGTCTTATACTCGAGTATAAGACCTAGAACCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005087.2-2199s21c1
Sequence:CCGGTGGGATCCCTAACGTAATATTCTCGAGAATATTACGTTAGGGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005087.2-1208s21c1
Sequence:CCGGACCTCCGGTTATGGTACAAATCTCGAGATTTGTACCATAACCGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-611s1c1
Sequence:CCGGCCAGAAATGAAGAGGCCACTACTCGAGTAGTGGCCTCTTCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1531s1c1
Sequence:CCGGCGTAGACGAAGGACTGATGAACTCGAGTTCATCAGTCCTTCGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-425s1c1
Sequence:CCGGGAGAGGCGTGTGCTAATGAAACTCGAGTTTCATTAGCACACGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-835s1c1
Sequence:CCGGGCTAGAGGTTTCTTGGAATTTCTCGAGAAATTCCAAGAAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-1028s1c1
Sequence:CCGGGCACTAAAGAAAGCATTGGAACTCGAGTTCCAATGCTTTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005087.1-310s1c1
Sequence:CCGGGACGCTACTTACAATGAAATACTCGAGTATTTCATTGTAAGTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005087.1-256s1c1
Sequence:CCGGGCTAAAGTTCGGATGATGAAACTCGAGTTTCATCATCCGAACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-130s1c1
Sequence:CCGGCGCCAGGTTCCATTTAATGAACTCGAGTTCATTAAATGGAACCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-579s1c1
Sequence:CCGGGCGAAGTATTCGTACGAAGTTCTCGAGAACTTCGTACGAATACTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1240s1c1
Sequence:CCGGGAAACGGAATCTGAGCGTAAACTCGAGTTTACGCTCAGATTCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005087.1-1490s1c1
Sequence:CCGGCCAGCGAATCTCATCACAGTACTCGAGTACTGTGATGAGATTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005087.1-1671s1c1
Sequence:CCGGCCCAAGGGAAACTTTGGCTAACTCGAGTTAGCCAAAGTTTCCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008053
VALIDATED
FXR1 MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation, autosomal homolog 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-161s21c1
Sequence:CCGGCCGTTTAATGAAGTGCGATTACTCGAGTAATCGCACTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008053.2-1894s21c1
Sequence:CCGGGCCAGTCTTACATCGCACTTTCTCGAGAAAGTGCGATGTAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-287s21c1
Sequence:CCGGCGGATGATGAAAGGCGAGTTTCTCGAGAAACTCGCCTTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-738s21c1
Sequence:CCGGGAACGCATGGCAGTAACATACCTCGAGGTATGTTACTGCCATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-1089s21c1
Sequence:CCGGAGTATCACATCGCTTACTTAACTCGAGTTAAGTAAGCGATGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-1873s1c1
Sequence:CCGGGCCAGTCTTACATCGCACTTTCTCGAGAAAGTGCGATGTAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-140s1c1
Sequence:CCGGCCGTTTAATGAAGTGCGATTACTCGAGTAATCGCACTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-1189s1c1
Sequence:CCGGCCCTAATTACACCTCCGGTTACTCGAGTAACCGGAGGTGTAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-266s1c1
Sequence:CCGGCGGATGATGAAAGGCGAGTTTCTCGAGAAACTCGCCTTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008053.1-1240s1c1
Sequence:CCGGCGAAACAGAATCTGAGCGTAACTCGAGTTACGCTCAGATTCTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008053
VALIDATED
FXR1 MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation, autosomal homolog 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-161s21c1
Sequence:CCGGCCGTTTAATGAAGTGCGATTACTCGAGTAATCGCACTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008053.2-1894s21c1
Sequence:CCGGGCCAGTCTTACATCGCACTTTCTCGAGAAAGTGCGATGTAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-287s21c1
Sequence:CCGGCGGATGATGAAAGGCGAGTTTCTCGAGAAACTCGCCTTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-738s21c1
Sequence:CCGGGAACGCATGGCAGTAACATACCTCGAGGTATGTTACTGCCATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-1089s21c1
Sequence:CCGGAGTATCACATCGCTTACTTAACTCGAGTTAAGTAAGCGATGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-1873s1c1
Sequence:CCGGGCCAGTCTTACATCGCACTTTCTCGAGAAAGTGCGATGTAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-140s1c1
Sequence:CCGGCCGTTTAATGAAGTGCGATTACTCGAGTAATCGCACTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-1189s1c1
Sequence:CCGGCCCTAATTACACCTCCGGTTACTCGAGTAACCGGAGGTGTAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-266s1c1
Sequence:CCGGCGGATGATGAAAGGCGAGTTTCTCGAGAAACTCGCCTTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008053.1-1240s1c1
Sequence:CCGGCGAAACAGAATCTGAGCGTAACTCGAGTTACGCTCAGATTCTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008053
VALIDATED
FXR1 MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation, autosomal homolog 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-161s21c1
Sequence:CCGGCCGTTTAATGAAGTGCGATTACTCGAGTAATCGCACTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008053.2-1894s21c1
Sequence:CCGGGCCAGTCTTACATCGCACTTTCTCGAGAAAGTGCGATGTAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-287s21c1
Sequence:CCGGCGGATGATGAAAGGCGAGTTTCTCGAGAAACTCGCCTTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-738s21c1
Sequence:CCGGGAACGCATGGCAGTAACATACCTCGAGGTATGTTACTGCCATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008053.2-1089s21c1
Sequence:CCGGAGTATCACATCGCTTACTTAACTCGAGTTAAGTAAGCGATGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-1873s1c1
Sequence:CCGGGCCAGTCTTACATCGCACTTTCTCGAGAAAGTGCGATGTAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-140s1c1
Sequence:CCGGCCGTTTAATGAAGTGCGATTACTCGAGTAATCGCACTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-1189s1c1
Sequence:CCGGCCCTAATTACACCTCCGGTTACTCGAGTAACCGGAGGTGTAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008053.1-266s1c1
Sequence:CCGGCGGATGATGAAAGGCGAGTTTCTCGAGAAACTCGCCTTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008053.1-1240s1c1
Sequence:CCGGCGAAACAGAATCTGAGCGTAACTCGAGTTACGCTCAGATTCTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks