EMAIL THIS PAGE TO A FRIEND

FXR2

fragile X mental retardation, autosomal homolog 2

111 Gene Product Result for
Synonyms: FMR1L2 FXR2P
UniProtKB ID: P51116, B2R9M2, D3DTQ1, Q86V09, Q8WUM2
Gene ID:
Human(9513) Summary: The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome. [provided by RefSeq, Jul 2008]
Mouse(23879) fragile X mental retardation, autosomal homolog 2
Rat(287433) fragile X mental retardation, autosomal homolog 2
domestic guinea pig(100735537) fragile X mental retardation, autosomal homolog 2
naked mole-rat(101699619) fragile X mental retardation, autosomal homolog 2
sheep(101119406) fragile X mental retardation, autosomal homolog 2
Domestic Rabbit(100343838) fragile X mental retardation, autosomal homolog 2
Zebrafish(393180) fragile X mental retardation, autosomal homolog 2
cow(618127) fragile X mental retardation, autosomal homolog 2
domestic cat(101099255) fragile X mental retardation, autosomal homolog 2
dog(489478) fragile X mental retardation, autosomal homolog 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063651 MISSION® esiRNA esiRNA targeting mouse Fxr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004860 Rosetta Predictions human pricing
NM_001100647 Rosetta Predictions rat pricing
NM_011814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073913 predicted 405
2 SASI_Hs02_00338472 predicted 685
3 SASI_Hs01_00073914 predicted 517
4 SASI_Hs01_00073915 predicted 452
5 SASI_Hs01_00073916 predicted 509
6 SASI_Hs02_00338473 predicted 905
7 SASI_Hs01_00073917 predicted 739
8 SASI_Hs01_00073918 predicted 1440
9 SASI_Hs01_00073919 predicted 1174
10 SASI_Hs01_00073921 predicted 783
11 SASI_Hs01_00073920 predicted 800
12 SASI_Hs01_00073922 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210178 predicted 626
2 SASI_Rn02_00210179 predicted 937
3 SASI_Rn02_00210180 predicted 1243
4 SASI_Rn02_00210181 predicted 661
5 SASI_Rn02_00210182 predicted 242
6 SASI_Rn02_00210183 predicted 319
7 SASI_Rn02_00210184 predicted 455
8 SASI_Rn02_00210185 predicted 2008
9 SASI_Rn02_00210186 predicted 482
10 SASI_Rn02_00210187 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321508 predicted 1266
2 SASI_Mm01_00031733 predicted 1585
3 SASI_Mm01_00031734 predicted 806
4 SASI_Mm01_00031735 predicted 2345
5 SASI_Mm01_00031736 predicted 981
6 SASI_Mm01_00031737 predicted 565
7 SASI_Mm01_00031739 predicted 1845
8 SASI_Mm01_00031740 predicted 918
9 SASI_Mm01_00031741 predicted 533
10 SASI_Mm01_00031742 predicted 441
11 SASI_Mm01_00031738 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004860
VALIDATED
FXR2 MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation, autosomal homolog 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-509s1c1
Sequence:CCGGGCGGATGATGAAGGGAGATTTCTCGAGAAATCTCCCTTCATCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004860.2-2493s1c1
Sequence:CCGGGATGTGCCTTTATCCTCTAATCTCGAGATTAGAGGATAAAGGCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004860.2-692s1c1
Sequence:CCGGCGTCCATAAAGAGTTCAAGAACTCGAGTTCTTGAACTCTTTATGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-833s1c1
Sequence:CCGGGCGCACCAAACTGCTACTTATCTCGAGATAAGTAGCAGTTTGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-1726s1c1
Sequence:CCGGCGAGATACAATTCTTCATCTACTCGAGTAGATGAAGAATTGTATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-2329s21c1
Sequence:CCGGGCTGGAGCTGCTCTTATCTAGCTCGAGCTAGATAAGAGCAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-509s21c1
Sequence:CCGGGCGGATGATGAAGGGAGATTTCTCGAGAAATCTCCCTTCATCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1436s21c1
Sequence:CCGGCAGCGACAAGGCTGGATATAGCTCGAGCTATATCCAGCCTTGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1349s21c1
Sequence:CCGGTCGCTTGGAGAGGCTACAAATCTCGAGATTTGTAGCCTCTCCAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1726s21c1
Sequence:CCGGCGAGATACAATTCTTCATCTACTCGAGTAGATGAAGAATTGTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004860
VALIDATED
FXR2 MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation, autosomal homolog 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-509s1c1
Sequence:CCGGGCGGATGATGAAGGGAGATTTCTCGAGAAATCTCCCTTCATCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004860.2-2493s1c1
Sequence:CCGGGATGTGCCTTTATCCTCTAATCTCGAGATTAGAGGATAAAGGCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004860.2-692s1c1
Sequence:CCGGCGTCCATAAAGAGTTCAAGAACTCGAGTTCTTGAACTCTTTATGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-833s1c1
Sequence:CCGGGCGCACCAAACTGCTACTTATCTCGAGATAAGTAGCAGTTTGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-1726s1c1
Sequence:CCGGCGAGATACAATTCTTCATCTACTCGAGTAGATGAAGAATTGTATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-2329s21c1
Sequence:CCGGGCTGGAGCTGCTCTTATCTAGCTCGAGCTAGATAAGAGCAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-509s21c1
Sequence:CCGGGCGGATGATGAAGGGAGATTTCTCGAGAAATCTCCCTTCATCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1436s21c1
Sequence:CCGGCAGCGACAAGGCTGGATATAGCTCGAGCTATATCCAGCCTTGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1349s21c1
Sequence:CCGGTCGCTTGGAGAGGCTACAAATCTCGAGATTTGTAGCCTCTCCAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1726s21c1
Sequence:CCGGCGAGATACAATTCTTCATCTACTCGAGTAGATGAAGAATTGTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004860
VALIDATED
FXR2 MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation, autosomal homolog 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-509s1c1
Sequence:CCGGGCGGATGATGAAGGGAGATTTCTCGAGAAATCTCCCTTCATCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004860.2-2493s1c1
Sequence:CCGGGATGTGCCTTTATCCTCTAATCTCGAGATTAGAGGATAAAGGCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004860.2-692s1c1
Sequence:CCGGCGTCCATAAAGAGTTCAAGAACTCGAGTTCTTGAACTCTTTATGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-833s1c1
Sequence:CCGGGCGCACCAAACTGCTACTTATCTCGAGATAAGTAGCAGTTTGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004860.2-1726s1c1
Sequence:CCGGCGAGATACAATTCTTCATCTACTCGAGTAGATGAAGAATTGTATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-2329s21c1
Sequence:CCGGGCTGGAGCTGCTCTTATCTAGCTCGAGCTAGATAAGAGCAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-509s21c1
Sequence:CCGGGCGGATGATGAAGGGAGATTTCTCGAGAAATCTCCCTTCATCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1436s21c1
Sequence:CCGGCAGCGACAAGGCTGGATATAGCTCGAGCTATATCCAGCCTTGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1349s21c1
Sequence:CCGGTCGCTTGGAGAGGCTACAAATCTCGAGATTTGTAGCCTCTCCAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004860.2-1726s21c1
Sequence:CCGGCGAGATACAATTCTTCATCTACTCGAGTAGATGAAGAATTGTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011814
VALIDATED
FXR2 MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation, autosomal homolog 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-225s1c1
Sequence:CCGGAGAGGTCTATTCGAGAGCCAACTCGAGTTGGCTCTCGAATAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-853s1c1
Sequence:CCGGGCTCGAAGCTACCTTGAATTTCTCGAGAAATTCAAGGTAGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-1491s1c1
Sequence:CCGGCCGGCCTACCTCAAGATATAACTCGAGTTATATCTTGAGGTAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-629s1c1
Sequence:CCGGCCCGCAATGAAGAAGCTACTACTCGAGTAGTAGCTTCTTCATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-572s21c1
Sequence:CCGGAGAGGTCTATTCGAGAGCCAACTCGAGTTGGCTCTCGAATAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011814.2-976s21c1
Sequence:CCGGCCCGCAATGAAGAAGCTACTACTCGAGTAGTAGCTTCTTCATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-943s21c1
Sequence:CCGGTCCGAAGCCTTCGCACCAAATCTCGAGATTTGGTGCGAAGGCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-2679s21c1
Sequence:CCGGCTCCTTGACCCACCCAGATTTCTCGAGAAATCTGGGTGGGTCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-1200s21c1
Sequence:CCGGGCTCGAAGCTACCTTGAATTTCTCGAGAAATTCAAGGTAGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011814
VALIDATED
FXR2 MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation, autosomal homolog 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-225s1c1
Sequence:CCGGAGAGGTCTATTCGAGAGCCAACTCGAGTTGGCTCTCGAATAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-853s1c1
Sequence:CCGGGCTCGAAGCTACCTTGAATTTCTCGAGAAATTCAAGGTAGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-1491s1c1
Sequence:CCGGCCGGCCTACCTCAAGATATAACTCGAGTTATATCTTGAGGTAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-629s1c1
Sequence:CCGGCCCGCAATGAAGAAGCTACTACTCGAGTAGTAGCTTCTTCATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-572s21c1
Sequence:CCGGAGAGGTCTATTCGAGAGCCAACTCGAGTTGGCTCTCGAATAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011814.2-976s21c1
Sequence:CCGGCCCGCAATGAAGAAGCTACTACTCGAGTAGTAGCTTCTTCATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-943s21c1
Sequence:CCGGTCCGAAGCCTTCGCACCAAATCTCGAGATTTGGTGCGAAGGCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-2679s21c1
Sequence:CCGGCTCCTTGACCCACCCAGATTTCTCGAGAAATCTGGGTGGGTCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-1200s21c1
Sequence:CCGGGCTCGAAGCTACCTTGAATTTCTCGAGAAATTCAAGGTAGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011814
VALIDATED
FXR2 MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation, autosomal homolog 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-225s1c1
Sequence:CCGGAGAGGTCTATTCGAGAGCCAACTCGAGTTGGCTCTCGAATAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-853s1c1
Sequence:CCGGGCTCGAAGCTACCTTGAATTTCTCGAGAAATTCAAGGTAGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-1491s1c1
Sequence:CCGGCCGGCCTACCTCAAGATATAACTCGAGTTATATCTTGAGGTAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011814.1-629s1c1
Sequence:CCGGCCCGCAATGAAGAAGCTACTACTCGAGTAGTAGCTTCTTCATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-572s21c1
Sequence:CCGGAGAGGTCTATTCGAGAGCCAACTCGAGTTGGCTCTCGAATAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011814.2-976s21c1
Sequence:CCGGCCCGCAATGAAGAAGCTACTACTCGAGTAGTAGCTTCTTCATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-943s21c1
Sequence:CCGGTCCGAAGCCTTCGCACCAAATCTCGAGATTTGGTGCGAAGGCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-2679s21c1
Sequence:CCGGCTCCTTGACCCACCCAGATTTCTCGAGAAATCTGGGTGGGTCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011814.2-1200s21c1
Sequence:CCGGGCTCGAAGCTACCTTGAATTTCTCGAGAAATTCAAGGTAGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks