EMAIL THIS PAGE TO A FRIEND

FXYD1

FXYD domain containing ion transport regulator 1

132 Gene Product Result for
Synonyms: PLM
UniProtKB ID: O00168, A8K196
Gene ID:
Human(5348) Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity. Transcript variants with different 5' UTR sequences have been described in the literature. [provided by RefSeq, Jul 2008]
Mouse(56188) FXYD domain-containing ion transport regulator 1
Rat(58971) FXYD domain-containing ion transport regulator 1
Zebrafish(503884) FXYD domain containing ion transport regulator 1 (phospholemman)
cow(616139) FXYD domain containing ion transport regulator 1
dog(476487) FXYD domain containing ion transport regulator 1
sheep(101115476) FXYD domain containing ion transport regulator 1
naked mole-rat(101705224) FXYD domain containing ion transport regulator 1
domestic guinea pig(100723906) FXYD domain containing ion transport regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005031 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005031 Rosetta Predictions human pricing
NM_021902 Rosetta Predictions human pricing
NM_031648 Rosetta Predictions rat pricing
NM_019503 Rosetta Predictions mouse pricing
NM_052991 Rosetta Predictions mouse pricing
NM_052992 Rosetta Predictions mouse pricing
NM_194321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056457 predicted 221
2 SASI_Hs01_00056455 predicted 222
3 SASI_Hs01_00056456 predicted 222
4 SASI_Hs01_00056458 predicted 213
5 SASI_Hs01_00056459 predicted 220
6 SASI_Hs01_00056460 predicted 212
7 SASI_Hs01_00056461 predicted 201
8 SASI_Hs01_00056463 predicted 278
9 SASI_Hs02_00338816 predicted 388
10 SASI_Hs01_00056462 predicted 108
11 SASI_Hs01_00056464 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231651 predicted 246
2 SASI_Hs01_00231658 predicted 358
3 SASI_Hs02_00355153 predicted 193
4 SASI_Hs01_00231650 predicted 72
5 SASI_Hs02_00355154 predicted 147
6 SASI_Hs01_00231653 predicted 285
7 SASI_Hs01_00231654 predicted 141
8 SASI_Hs01_00231655 predicted 69
9 SASI_Hs01_00231656 predicted 74
10 SASI_Hs01_00231657 predicted 226
11 SASI_Hs01_00231652 predicted 300
12 SASI_Hs01_00231659 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044839 predicted 68
2 SASI_Rn01_00044840 predicted 99
3 SASI_Rn01_00044842 predicted 77
4 SASI_Rn01_00044843 predicted 210
5 SASI_Rn01_00044844 predicted 122
6 SASI_Rn01_00044845 predicted 172
7 SASI_Rn01_00044846 predicted 102
8 SASI_Rn01_00044847 predicted 215
9 SASI_Rn02_00264964 predicted 5
10 SASI_Rn02_00264965 predicted 173
11 SASI_Rn01_00044838 predicted 71
12 SASI_Rn01_00044841 predicted 153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130780 predicted 231
2 SASI_Mm01_00130781 predicted 209
3 SASI_Mm01_00130782 predicted 254
4 SASI_Mm01_00130783 predicted 213
5 SASI_Mm01_00130784 predicted 325
6 SASI_Mm01_00130785 predicted 278
7 SASI_Mm01_00130786 predicted 255
8 SASI_Mm02_00324541 predicted 265
9 SASI_Mm01_00130788 predicted 275
10 SASI_Mm01_00130789 predicted 215
11 SASI_Mm01_00130787 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021400 predicted 220
2 SASI_Mm01_00021401 predicted 283
3 SASI_Mm01_00021402 predicted 237
4 SASI_Mm01_00021403 predicted 225
5 SASI_Mm01_00021404 predicted 287
6 SASI_Mm01_00021405 predicted 222
7 SASI_Mm01_00021406 predicted 244
8 SASI_Mm01_00021407 predicted 244
9 SASI_Mm01_00021408 predicted 221
10 SASI_Mm02_00337499 predicted 246
11 SASI_Mm01_00021399 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337500 predicted 290
2 SASI_Mm02_00337501 predicted 281
3 SASI_Mm02_00337502 predicted 318
4 SASI_Mm02_00337503 predicted 271
5 SASI_Mm02_00337504 predicted 244
6 SASI_Mm02_00337505 predicted 385
7 SASI_Mm02_00337506 predicted 328
8 SASI_Mm02_00337507 predicted 241
9 SASI_Mm02_00337508 predicted 245
10 SASI_Mm02_00337509 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175285 predicted 276
2 SASI_Mm01_00175286 predicted 259
3 SASI_Mm01_00175287 predicted 304
4 SASI_Mm01_00175288 predicted 259
5 SASI_Mm01_00175289 predicted 228
6 SASI_Mm01_00175290 predicted 366
7 SASI_Mm02_00350607 predicted 307
8 SASI_Mm01_00175291 predicted 231
9 SASI_Mm01_00175292 predicted 231
10 SASI_Mm01_00175293 predicted 264
11 SASI_Mm01_00175294 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019503
FXYD1 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-236s21c1
Sequence:CCGGTATCGCTGGGATCCTCTTCATCTCGAGATGAAGAGGATCCCAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-165s21c1
Sequence:CCGGAGTGCAGAAGCTCCACAGGAACTCGAGTTCCTGTGGAGCTTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019503.4-397s21c1
Sequence:CCGGACCTGACTCCAGGAAACTCAGCTCGAGCTGAGTTTCCTGGAGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-292s21c1
Sequence:CCGGGATGCAAATTCAACCAACAGCCTCGAGGCTGTTGGTTGAATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-279s1c1
Sequence:CCGGGCAAGAGATGTCGATGCAAATCTCGAGATTTGCATCGACATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-280s1c1
Sequence:CCGGCAAGAGATGTCGATGCAAATTCTCGAGAATTTGCATCGACATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-262s1c1
Sequence:CCGGCATCCTTATCATCCTTAGCAACTCGAGTTGCTAAGGATGATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-202s1c1
Sequence:CCGGCGATTACCACACCCTGCGGATCTCGAGATCCGCAGGGTGTGGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-186s1c1
Sequence:CCGGCGGATCCATTCACCTACGATTCTCGAGAATCGTAGGTGAATGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019503
FXYD1 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-236s21c1
Sequence:CCGGTATCGCTGGGATCCTCTTCATCTCGAGATGAAGAGGATCCCAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-165s21c1
Sequence:CCGGAGTGCAGAAGCTCCACAGGAACTCGAGTTCCTGTGGAGCTTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019503.4-397s21c1
Sequence:CCGGACCTGACTCCAGGAAACTCAGCTCGAGCTGAGTTTCCTGGAGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-292s21c1
Sequence:CCGGGATGCAAATTCAACCAACAGCCTCGAGGCTGTTGGTTGAATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-279s1c1
Sequence:CCGGGCAAGAGATGTCGATGCAAATCTCGAGATTTGCATCGACATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-280s1c1
Sequence:CCGGCAAGAGATGTCGATGCAAATTCTCGAGAATTTGCATCGACATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-262s1c1
Sequence:CCGGCATCCTTATCATCCTTAGCAACTCGAGTTGCTAAGGATGATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-202s1c1
Sequence:CCGGCGATTACCACACCCTGCGGATCTCGAGATCCGCAGGGTGTGGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-186s1c1
Sequence:CCGGCGGATCCATTCACCTACGATTCTCGAGAATCGTAGGTGAATGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019503
FXYD1 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-236s21c1
Sequence:CCGGTATCGCTGGGATCCTCTTCATCTCGAGATGAAGAGGATCCCAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-165s21c1
Sequence:CCGGAGTGCAGAAGCTCCACAGGAACTCGAGTTCCTGTGGAGCTTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019503.4-397s21c1
Sequence:CCGGACCTGACTCCAGGAAACTCAGCTCGAGCTGAGTTTCCTGGAGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019503.4-292s21c1
Sequence:CCGGGATGCAAATTCAACCAACAGCCTCGAGGCTGTTGGTTGAATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-279s1c1
Sequence:CCGGGCAAGAGATGTCGATGCAAATCTCGAGATTTGCATCGACATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-280s1c1
Sequence:CCGGCAAGAGATGTCGATGCAAATTCTCGAGAATTTGCATCGACATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-262s1c1
Sequence:CCGGCATCCTTATCATCCTTAGCAACTCGAGTTGCTAAGGATGATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-202s1c1
Sequence:CCGGCGATTACCACACCCTGCGGATCTCGAGATCCGCAGGGTGTGGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019503.2-186s1c1
Sequence:CCGGCGGATCCATTCACCTACGATTCTCGAGAATCGTAGGTGAATGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005031
FXYD1 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-260s21c1
Sequence:CCGGTCCTCATCGTGCTGAGCAGAACTCGAGTTCTGCTCAGCACGATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-278s21c1
Sequence:CCGGGAAGATGCCGGTGCAAGTTCACTCGAGTGAACTTGCACCGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-195s21c1
Sequence:CCGGTTACGACTACCAGTCCCTGCACTCGAGTGCAGGGACTGGTAGTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-323s1c1
Sequence:CCGGCCGATGAAGAGGAGGGAACTTCTCGAGAAGTTCCCTCCTCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-240s1c1
Sequence:CCGGGATCCTCTTCATCCTGGGCATCTCGAGATGCCCAGGATGAAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-165s1c1
Sequence:CCGGAGAAAGTCCAAAGGAACACGACTCGAGTCGTGTTCCTTTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-183s1c1
Sequence:CCGGCGACCCGTTCACTTACGACTACTCGAGTAGTCGTAAGTGAACGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-290s1c1
Sequence:CCGGGCAAGTTCAACCAGCAGCAGACTCGAGTCTGCTGCTGGTTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005031
FXYD1 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-260s21c1
Sequence:CCGGTCCTCATCGTGCTGAGCAGAACTCGAGTTCTGCTCAGCACGATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-278s21c1
Sequence:CCGGGAAGATGCCGGTGCAAGTTCACTCGAGTGAACTTGCACCGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-195s21c1
Sequence:CCGGTTACGACTACCAGTCCCTGCACTCGAGTGCAGGGACTGGTAGTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-323s1c1
Sequence:CCGGCCGATGAAGAGGAGGGAACTTCTCGAGAAGTTCCCTCCTCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-240s1c1
Sequence:CCGGGATCCTCTTCATCCTGGGCATCTCGAGATGCCCAGGATGAAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-165s1c1
Sequence:CCGGAGAAAGTCCAAAGGAACACGACTCGAGTCGTGTTCCTTTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-183s1c1
Sequence:CCGGCGACCCGTTCACTTACGACTACTCGAGTAGTCGTAAGTGAACGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-290s1c1
Sequence:CCGGGCAAGTTCAACCAGCAGCAGACTCGAGTCTGCTGCTGGTTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005031
FXYD1 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-260s21c1
Sequence:CCGGTCCTCATCGTGCTGAGCAGAACTCGAGTTCTGCTCAGCACGATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-278s21c1
Sequence:CCGGGAAGATGCCGGTGCAAGTTCACTCGAGTGAACTTGCACCGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005031.3-195s21c1
Sequence:CCGGTTACGACTACCAGTCCCTGCACTCGAGTGCAGGGACTGGTAGTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-323s1c1
Sequence:CCGGCCGATGAAGAGGAGGGAACTTCTCGAGAAGTTCCCTCCTCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-240s1c1
Sequence:CCGGGATCCTCTTCATCCTGGGCATCTCGAGATGCCCAGGATGAAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-165s1c1
Sequence:CCGGAGAAAGTCCAAAGGAACACGACTCGAGTCGTGTTCCTTTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-183s1c1
Sequence:CCGGCGACCCGTTCACTTACGACTACTCGAGTAGTCGTAAGTGAACGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005031.3-290s1c1
Sequence:CCGGGCAAGTTCAACCAGCAGCAGACTCGAGTCTGCTGCTGGTTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks