EMAIL THIS PAGE TO A FRIEND

FXYD2

FXYD domain containing ion transport regulator 2

108 Gene Product Result for
Synonyms: ATP1G1 HOMG2
UniProtKB ID: P54710, Q15332, Q53YC1, Q9GZP3, Q9GZQ7
Gene ID:
Human(486) Summary: This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011]
Mouse(11936) FXYD domain-containing ion transport regulator 2
Rat(29639) FXYD domain-containing ion transport regulator 2
domestic guinea pig(100730279) FXYD domain containing ion transport regulator 2
naked mole-rat(101704851) FXYD domain containing ion transport regulator 2
dog(608594) FXYD domain containing ion transport regulator 2
domestic cat(101087093) FXYD domain containing ion transport regulator 2
cow(281773) FXYD domain containing ion transport regulator 2
Horse(100071154) FXYD domain containing ion transport regulator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001680 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135501 MISSION® esiRNA esiRNA human FXYD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127489 Rosetta Predictions human pricing
NM_001680 Rosetta Predictions human pricing
NM_021603 Rosetta Predictions human pricing
NM_017349 Rosetta Predictions rat pricing
NM_145717 Rosetta Predictions rat pricing
NM_007503 Rosetta Predictions mouse pricing
NM_052823 Rosetta Predictions mouse pricing
NM_052824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329654 predicted 473
2 SASI_Hs02_00329655 predicted 840
3 SASI_Hs02_00329656 predicted 847
4 SASI_Hs02_00329657 predicted 579
5 SASI_Hs02_00329658 predicted 886
6 SASI_Hs02_00329659 predicted 2612
7 SASI_Hs02_00329660 predicted 2111
8 SASI_Hs02_00329661 predicted 2556
9 SASI_Hs02_00329662 predicted 1398
10 SASI_Hs02_00329663 predicted 2132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075154 predicted 278
2 SASI_Hs01_00075155 predicted 225
3 SASI_Hs01_00075156 predicted 221
4 SASI_Hs01_00075157 predicted 230
5 SASI_Hs01_00075158 predicted 346
6 SASI_Hs01_00075159 predicted 267
7 SASI_Hs01_00075160 predicted 224
8 SASI_Hs01_00075161 predicted 273
9 SASI_Hs01_00075162 predicted 234
10 SASI_Hs01_00075163 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183100 predicted 281
2 SASI_Hs01_00183101 predicted 240
3 SASI_Hs01_00183102 predicted 233
4 SASI_Hs01_00183103 predicted 239
5 SASI_Hs01_00183104 predicted 351
6 SASI_Hs01_00183105 predicted 276
7 SASI_Hs01_00183106 predicted 232
8 SASI_Hs01_00183107 predicted 275
9 SASI_Hs01_00183108 predicted 234
10 SASI_Hs01_00183109 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068162 predicted 37
2 SASI_Rn01_00068164 predicted 32
3 SASI_Rn02_00261834 predicted 159
4 SASI_Rn02_00261835 predicted 159
5 SASI_Rn01_00068166 predicted 66
6 SASI_Rn02_00261836 predicted 163
7 SASI_Rn01_00068167 predicted 67
8 SASI_Rn01_00068168 predicted 35
9 SASI_Rn01_00068169 predicted 67
10 SASI_Rn02_00261837 predicted 105
11 SASI_Rn01_00068161 predicted 47
12 SASI_Rn01_00068163 predicted 43
13 SASI_Rn01_00068165 predicted 50
14 SASI_Rn01_00068170 predicted 35
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051144 predicted 80
2 SASI_Rn01_00051145 predicted 81
3 SASI_Rn01_00051146 predicted 85
4 SASI_Rn01_00051147 predicted 76
5 SASI_Rn01_00051148 predicted 204
6 SASI_Rn01_00051149 predicted 197
7 SASI_Rn01_00051150 predicted 105
8 SASI_Rn01_00051151 predicted 114
9 SASI_Rn01_00051152 predicted 75
10 SASI_Rn01_00051153 predicted 87
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179741 predicted 246
2 SASI_Mm01_00179742 predicted 234
3 SASI_Mm02_00311782 predicted 269
4 SASI_Mm01_00179745 predicted 229
5 SASI_Mm01_00179747 predicted 230
6 SASI_Mm02_00311783 predicted 245
7 SASI_Mm01_00179743 predicted 248
8 SASI_Mm01_00179748 predicted 239
9 SASI_Mm01_00179749 predicted 234
10 SASI_Mm02_00311784 predicted 230
11 SASI_Mm01_00179744 predicted 255
12 SASI_Mm01_00179746 predicted 268
13 SASI_Mm01_00179750 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162270 predicted 315
2 SASI_Mm02_00337488 predicted 345
3 SASI_Mm02_00337489 predicted 209
4 SASI_Mm01_00162275 predicted 300
5 SASI_Mm01_00162271 predicted 324
6 SASI_Mm02_00337490 predicted 215
7 SASI_Mm02_00337491 predicted 216
8 SASI_Mm02_00337492 predicted 194
9 SASI_Mm01_00162279 predicted 303
10 SASI_Mm02_00337493 predicted 252
11 SASI_Mm01_00162272 predicted 317
12 SASI_Mm01_00162273 predicted 276
13 SASI_Mm01_00162274 predicted 331
14 SASI_Mm01_00162276 predicted 222
15 SASI_Mm01_00162277 predicted 328
16 SASI_Mm01_00162278 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126217 predicted 820
2 SASI_Mm01_00126218 predicted 959
3 SASI_Mm01_00126219 predicted 765
4 SASI_Mm01_00126220 predicted 820
5 SASI_Mm01_00126221 predicted 772
6 SASI_Mm01_00126222 predicted 943
7 SASI_Mm01_00126223 predicted 713
8 SASI_Mm01_00126224 predicted 815
9 SASI_Mm01_00126225 predicted 687
10 SASI_Mm01_00126226 predicted 817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007503
FXYD2 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007503.2-385s1c1
Sequence:CCGGCGTGCCTCAGATCCTTAACTTCTCGAGAAGTTAAGGATCTGAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-209s1c1
Sequence:CCGGGTAAGAAACATAGGCAGGTCACTCGAGTGACCTGCCTATGTTTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-87s1c1
Sequence:CCGGGACAGAGAATCCCTTCGAGTACTCGAGTACTCGAAGGGATTCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-97s1c1
Sequence:CCGGCCCTTCGAGTACGACTATGAACTCGAGTTCATAGTCGTACTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-108s1c1
Sequence:CCGGCGACTATGAAACCGTCCGCAACTCGAGTTGCGGACGGTTTCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-144s21c1
Sequence:CCGGCGCAAAGGAGGCCTGATCTTCCTCGAGGAAGATCAGGCCTCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-181s21c1
Sequence:CCGGTCGTGGGCCTCCTCATCATTCCTCGAGGAATGATGAGGAGGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-254s21c1
Sequence:CCGGAGATGAACTGTGACAGAAGAGCTCGAGCTCTTCTGTCACAGTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007503
FXYD2 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007503.2-385s1c1
Sequence:CCGGCGTGCCTCAGATCCTTAACTTCTCGAGAAGTTAAGGATCTGAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-209s1c1
Sequence:CCGGGTAAGAAACATAGGCAGGTCACTCGAGTGACCTGCCTATGTTTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-87s1c1
Sequence:CCGGGACAGAGAATCCCTTCGAGTACTCGAGTACTCGAAGGGATTCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-97s1c1
Sequence:CCGGCCCTTCGAGTACGACTATGAACTCGAGTTCATAGTCGTACTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-108s1c1
Sequence:CCGGCGACTATGAAACCGTCCGCAACTCGAGTTGCGGACGGTTTCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-144s21c1
Sequence:CCGGCGCAAAGGAGGCCTGATCTTCCTCGAGGAAGATCAGGCCTCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-181s21c1
Sequence:CCGGTCGTGGGCCTCCTCATCATTCCTCGAGGAATGATGAGGAGGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-254s21c1
Sequence:CCGGAGATGAACTGTGACAGAAGAGCTCGAGCTCTTCTGTCACAGTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007503
FXYD2 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007503.2-385s1c1
Sequence:CCGGCGTGCCTCAGATCCTTAACTTCTCGAGAAGTTAAGGATCTGAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-209s1c1
Sequence:CCGGGTAAGAAACATAGGCAGGTCACTCGAGTGACCTGCCTATGTTTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-87s1c1
Sequence:CCGGGACAGAGAATCCCTTCGAGTACTCGAGTACTCGAAGGGATTCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-97s1c1
Sequence:CCGGCCCTTCGAGTACGACTATGAACTCGAGTTCATAGTCGTACTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007503.2-108s1c1
Sequence:CCGGCGACTATGAAACCGTCCGCAACTCGAGTTGCGGACGGTTTCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-144s21c1
Sequence:CCGGCGCAAAGGAGGCCTGATCTTCCTCGAGGAAGATCAGGCCTCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-181s21c1
Sequence:CCGGTCGTGGGCCTCCTCATCATTCCTCGAGGAATGATGAGGAGGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007503.3-254s21c1
Sequence:CCGGAGATGAACTGTGACAGAAGAGCTCGAGCTCTTCTGTCACAGTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001680
VALIDATED
FXYD2 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-213s1c1
Sequence:CCGGCGCAGGCAAATCAATGAAGATCTCGAGATCTTCATTGATTTGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-98s1c1
Sequence:CCGGCTACTATGACTATGAGACCGTCTCGAGACGGTCTCATAGTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001680.3-170s1c1
Sequence:CCGGCATCCTCCTCAGCAGAAGATTCTCGAGAATCTTCTGCTGAGGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001680.3-90s1c1
Sequence:CCGGGACCCGTTCTACTATGACTATCTCGAGATAGTCATAGTAGAACGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-202s1c1
Sequence:CCGGGCAATAAGAAGCGCAGGCAAACTCGAGTTTGCCTGCGCTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001680
VALIDATED
FXYD2 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-213s1c1
Sequence:CCGGCGCAGGCAAATCAATGAAGATCTCGAGATCTTCATTGATTTGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-98s1c1
Sequence:CCGGCTACTATGACTATGAGACCGTCTCGAGACGGTCTCATAGTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001680.3-170s1c1
Sequence:CCGGCATCCTCCTCAGCAGAAGATTCTCGAGAATCTTCTGCTGAGGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001680.3-90s1c1
Sequence:CCGGGACCCGTTCTACTATGACTATCTCGAGATAGTCATAGTAGAACGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-202s1c1
Sequence:CCGGGCAATAAGAAGCGCAGGCAAACTCGAGTTTGCCTGCGCTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001680
VALIDATED
FXYD2 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-213s1c1
Sequence:CCGGCGCAGGCAAATCAATGAAGATCTCGAGATCTTCATTGATTTGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-98s1c1
Sequence:CCGGCTACTATGACTATGAGACCGTCTCGAGACGGTCTCATAGTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001680.3-170s1c1
Sequence:CCGGCATCCTCCTCAGCAGAAGATTCTCGAGAATCTTCTGCTGAGGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001680.3-90s1c1
Sequence:CCGGGACCCGTTCTACTATGACTATCTCGAGATAGTCATAGTAGAACGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001680.3-202s1c1
Sequence:CCGGGCAATAAGAAGCGCAGGCAAACTCGAGTTTGCCTGCGCTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks