EMAIL THIS PAGE TO A FRIEND

FXYD3

FXYD domain containing ion transport regulator 3

Synonyms: MAT8 PLML
Gene ID:
Human(5349) Summary: This gene belongs to a small family of FXYD-domain containing regulators of Na+/K+ ATPases which share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD, and containing 7 invariant and 6 highly conserved amino acids. This gene encodes a cell membrane protein that may regulate the function of ion-pumps and ion-channels. This gene may also play a role in tumor progression. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
Mouse(17178) FXYD domain-containing ion transport regulator 3
Rat(116831) FXYD domain-containing ion transport regulator 3
domestic cat(101088380) FXYD domain containing ion transport regulator 3
dog(612671) FXYD domain containing ion transport regulator 3
cow(780807) FXYD domain containing ion transport regulator 3
sheep(101106615) FXYD domain containing ion transport regulator 3
naked mole-rat(101703783) FXYD domain containing ion transport regulator 3
domestic guinea pig(100720865) FXYD domain containing ion transport regulator 3
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005971 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005971 Rosetta Predictions human pricing
NM_021910 Rosetta Predictions human pricing
NM_172317 Rosetta Predictions rat pricing
NM_008557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227309 predicted 865
2 SASI_Hs02_00340651 predicted 864
3 SASI_Hs01_00227310 predicted 929
4 SASI_Hs01_00227311 predicted 839
5 SASI_Hs01_00227312 predicted 639
6 SASI_Hs01_00227313 predicted 559
7 SASI_Hs01_00227314 predicted 760
8 SASI_Hs01_00227315 predicted 831
9 SASI_Hs01_00227316 predicted 823
10 SASI_Hs01_00227317 predicted 815
11 SASI_Hs01_00227318 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091921 predicted 1027
2 SASI_Hs02_00355182 predicted 1024
3 SASI_Hs01_00091922 predicted 1096
4 SASI_Hs01_00091923 predicted 999
5 SASI_Hs01_00091924 predicted 804
6 SASI_Hs01_00091925 predicted 726
7 SASI_Hs01_00091926 predicted 922
8 SASI_Hs01_00091927 predicted 994
9 SASI_Hs01_00091928 predicted 982
10 SASI_Hs01_00091929 predicted 979
11 SASI_Hs01_00091930 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269201 predicted 202
2 SASI_Rn01_00064039 predicted 233
3 SASI_Rn02_00269202 predicted 203
4 SASI_Rn02_00269203 predicted 212
5 SASI_Rn01_00064040 predicted 406
6 SASI_Rn01_00064041 predicted 292
7 SASI_Rn02_00269204 predicted 82
8 SASI_Rn02_00269205 predicted 409
9 SASI_Rn01_00064042 predicted 145
10 SASI_Rn01_00064043 predicted 174
11 SASI_Rn01_00064044 predicted 179
12 SASI_Rn01_00064045 predicted 63
13 SASI_Rn01_00064046 predicted 124
14 SASI_Rn01_00064047 predicted 150
15 SASI_Rn01_00064048 predicted 44
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191670 predicted 206
2 SASI_Mm01_00191671 predicted 203
3 SASI_Mm01_00191672 predicted 252
4 SASI_Mm01_00191673 predicted 238
5 SASI_Mm01_00191674 predicted 203
6 SASI_Mm01_00191675 predicted 224
7 SASI_Mm01_00191677 predicted 236
8 SASI_Mm01_00191678 predicted 249
9 SASI_Mm01_00191679 predicted 244
10 SASI_Mm02_00314148 predicted 225
11 SASI_Mm01_00191676 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005971
FXYD3 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-951s21c1
Sequence:CCGGAGATGGAACACTGGAACATTCCTCGAGGAATGTTCCAGTGTTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005971.3-463s21c1
Sequence:CCGGGGGAGACTCCACCTCTCATCACTCGAGTGATGAGAGGTGGAGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-645s21c1
Sequence:CCGGTCTCGCAAGAGGGTCTCTTTGCTCGAGCAAAGAGACCCTCTTGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-929s21c1
Sequence:CCGGGGAATGAAAGAGAGCTCTAACCTCGAGGTTAGAGCTCTCTTTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-233s1c1
Sequence:CCGGGCCAATGACCTAGAAGATAAACTCGAGTTTATCTTCTAGGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-358s1c1
Sequence:CCGGCAAATGCAAGTTTGGCCAGAACTCGAGTTCTGGCCAAACTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-261s1c1
Sequence:CCGGCTTTCTACTATGACTGGCACACTCGAGTGTGCCAGTCATAGTAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005971
FXYD3 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-951s21c1
Sequence:CCGGAGATGGAACACTGGAACATTCCTCGAGGAATGTTCCAGTGTTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005971.3-463s21c1
Sequence:CCGGGGGAGACTCCACCTCTCATCACTCGAGTGATGAGAGGTGGAGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-645s21c1
Sequence:CCGGTCTCGCAAGAGGGTCTCTTTGCTCGAGCAAAGAGACCCTCTTGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-929s21c1
Sequence:CCGGGGAATGAAAGAGAGCTCTAACCTCGAGGTTAGAGCTCTCTTTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-233s1c1
Sequence:CCGGGCCAATGACCTAGAAGATAAACTCGAGTTTATCTTCTAGGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-358s1c1
Sequence:CCGGCAAATGCAAGTTTGGCCAGAACTCGAGTTCTGGCCAAACTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-261s1c1
Sequence:CCGGCTTTCTACTATGACTGGCACACTCGAGTGTGCCAGTCATAGTAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005971
FXYD3 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-951s21c1
Sequence:CCGGAGATGGAACACTGGAACATTCCTCGAGGAATGTTCCAGTGTTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005971.3-463s21c1
Sequence:CCGGGGGAGACTCCACCTCTCATCACTCGAGTGATGAGAGGTGGAGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-645s21c1
Sequence:CCGGTCTCGCAAGAGGGTCTCTTTGCTCGAGCAAAGAGACCCTCTTGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005971.3-929s21c1
Sequence:CCGGGGAATGAAAGAGAGCTCTAACCTCGAGGTTAGAGCTCTCTTTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-233s1c1
Sequence:CCGGGCCAATGACCTAGAAGATAAACTCGAGTTTATCTTCTAGGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-358s1c1
Sequence:CCGGCAAATGCAAGTTTGGCCAGAACTCGAGTTCTGGCCAAACTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005971.2-261s1c1
Sequence:CCGGCTTTCTACTATGACTGGCACACTCGAGTGTGCCAGTCATAGTAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008557
FXYD3 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008557.2-332s21c1
Sequence:CCGGACACCAGGCTCAGCTCACAACCTCGAGGTTGTGAGCTGAGCCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008557.2-172s21c1
Sequence:CCGGTGATCCTTTCTACTATGATTGCTCGAGCAATCATAGTAGAAAGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008557.1-372s1c1
Sequence:CCGGGAGCACAGGTCCTGGCTCTGACTCGAGTCAGAGCCAGGACCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-207s1c1
Sequence:CCGGCGGGCTCATTTGTGCAGGGATCTCGAGATCCCTGCACAAATGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-132s1c1
Sequence:CCGGGCCTACTTTGGATGCCAATGACTCGAGTCATTGGCATCCAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-237s1c1
Sequence:CCGGCCTGGGCATTATAGTCCTTATCTCGAGATAAGGACTATAATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-270s1c1
Sequence:CCGGCAAATGCAAGTTCAGACAGAACTCGAGTTCTGTCTGAACTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008557
FXYD3 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008557.2-332s21c1
Sequence:CCGGACACCAGGCTCAGCTCACAACCTCGAGGTTGTGAGCTGAGCCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008557.2-172s21c1
Sequence:CCGGTGATCCTTTCTACTATGATTGCTCGAGCAATCATAGTAGAAAGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008557.1-372s1c1
Sequence:CCGGGAGCACAGGTCCTGGCTCTGACTCGAGTCAGAGCCAGGACCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-207s1c1
Sequence:CCGGCGGGCTCATTTGTGCAGGGATCTCGAGATCCCTGCACAAATGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-132s1c1
Sequence:CCGGGCCTACTTTGGATGCCAATGACTCGAGTCATTGGCATCCAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-237s1c1
Sequence:CCGGCCTGGGCATTATAGTCCTTATCTCGAGATAAGGACTATAATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-270s1c1
Sequence:CCGGCAAATGCAAGTTCAGACAGAACTCGAGTTCTGTCTGAACTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008557
FXYD3 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008557.2-332s21c1
Sequence:CCGGACACCAGGCTCAGCTCACAACCTCGAGGTTGTGAGCTGAGCCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008557.2-172s21c1
Sequence:CCGGTGATCCTTTCTACTATGATTGCTCGAGCAATCATAGTAGAAAGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008557.1-372s1c1
Sequence:CCGGGAGCACAGGTCCTGGCTCTGACTCGAGTCAGAGCCAGGACCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-207s1c1
Sequence:CCGGCGGGCTCATTTGTGCAGGGATCTCGAGATCCCTGCACAAATGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-132s1c1
Sequence:CCGGGCCTACTTTGGATGCCAATGACTCGAGTCATTGGCATCCAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-237s1c1
Sequence:CCGGCCTGGGCATTATAGTCCTTATCTCGAGATAAGGACTATAATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008557.1-270s1c1
Sequence:CCGGCAAATGCAAGTTCAGACAGAACTCGAGTTCTGTCTGAACTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks