EMAIL THIS PAGE TO A FRIEND

FXYD4

FXYD domain containing ion transport regulator 4

46 Gene Product Result for
Synonyms: CHIF
UniProtKB ID: P59646, Q6UWZ1, Q7Z4M5
Gene ID:
Human(53828) Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. FXYD4, originally named CHIF for channel-inducing factor, has been shown to modulate the properties of the Na,K-ATPase, as has FXYD2, also known as the gamma subunit of the Na,K-ATPase, and FXYD7. Transmembrane topology has been established for FXYD4 and two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. Alternatively spliced transcript variants encoding the same protein have been found.[provided by RefSeq, May 2010]
Mouse(108017) FXYD domain-containing ion transport regulator 4
Rat(64190) FXYD domain-containing ion transport regulator 4
domestic guinea pig(100733950) FXYD domain containing ion transport regulator 4
naked mole-rat(101720686) FXYD domain containing ion transport regulator 4
sheep(101118499) FXYD domain containing ion transport regulator 4
Horse(100050067) FXYD domain containing ion transport regulator 4
cow(100295639) FXYD domain containing ion transport regulator 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173160 Rosetta Predictions human pricing
NM_022388 Rosetta Predictions rat pricing
NM_033648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114876 predicted 381
2 SASI_Hs01_00114877 predicted 497
3 SASI_Hs01_00114878 predicted 382
4 SASI_Hs01_00114879 predicted 409
5 SASI_Hs01_00114880 predicted 396
6 SASI_Hs01_00114881 predicted 363
7 SASI_Hs01_00114882 predicted 413
8 SASI_Hs01_00114883 predicted 497
9 SASI_Hs01_00114884 predicted 328
10 SASI_Hs01_00114885 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113981 predicted 981
2 SASI_Rn01_00113982 predicted 983
3 SASI_Rn01_00113983 predicted 927
4 SASI_Rn01_00113984 predicted 923
5 SASI_Rn01_00113985 predicted 1033
6 SASI_Rn01_00113986 predicted 1135
7 SASI_Rn01_00113987 predicted 1037
8 SASI_Rn01_00113988 predicted 1029
9 SASI_Rn01_00113989 predicted 1028
10 SASI_Rn01_00113990 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099828 predicted 219
2 SASI_Mm01_00099829 predicted 244
3 SASI_Mm01_00099830 predicted 274
4 SASI_Mm01_00099832 predicted 276
5 SASI_Mm01_00099833 predicted 305
6 SASI_Mm01_00099834 predicted 306
7 SASI_Mm01_00099835 predicted 288
8 SASI_Mm01_00099836 predicted 298
9 SASI_Mm02_00337486 predicted 220
10 SASI_Mm01_00099837 predicted 196
11 SASI_Mm01_00099831 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033648
FXYD4 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-293s1c1
Sequence:CCGGGCAAGTGCAAATGTAGGCGTACTCGAGTACGCCTACATTTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-175s1c1
Sequence:CCGGGCCAGTGACCCAGTTGATAAACTCGAGTTTATCAACTGGGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-299s1c1
Sequence:CCGGGCAAATGTAGGCGTACCCATACTCGAGTATGGGTACGCCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-321s1c1
Sequence:CCGGGCCCAGTTCCTTACCTGGAAACTCGAGTTTCCAGGTAAGGAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-189s1c1
Sequence:CCGGTGATAAAGACAGTCCCTTCTACTCGAGTAGAAGGGACTGTCTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033648
FXYD4 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-293s1c1
Sequence:CCGGGCAAGTGCAAATGTAGGCGTACTCGAGTACGCCTACATTTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-175s1c1
Sequence:CCGGGCCAGTGACCCAGTTGATAAACTCGAGTTTATCAACTGGGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-299s1c1
Sequence:CCGGGCAAATGTAGGCGTACCCATACTCGAGTATGGGTACGCCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-321s1c1
Sequence:CCGGGCCCAGTTCCTTACCTGGAAACTCGAGTTTCCAGGTAAGGAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-189s1c1
Sequence:CCGGTGATAAAGACAGTCCCTTCTACTCGAGTAGAAGGGACTGTCTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033648
FXYD4 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-293s1c1
Sequence:CCGGGCAAGTGCAAATGTAGGCGTACTCGAGTACGCCTACATTTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-175s1c1
Sequence:CCGGGCCAGTGACCCAGTTGATAAACTCGAGTTTATCAACTGGGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-299s1c1
Sequence:CCGGGCAAATGTAGGCGTACCCATACTCGAGTATGGGTACGCCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-321s1c1
Sequence:CCGGGCCCAGTTCCTTACCTGGAAACTCGAGTTTCCAGGTAAGGAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033648.1-189s1c1
Sequence:CCGGTGATAAAGACAGTCCCTTCTACTCGAGTAGAAGGGACTGTCTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173160
FXYD4 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-515s1c1
Sequence:CCGGCAAATGCAAGAGCAGCCAGAACTCGAGTTCTGGCTGCTCTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-396s1c1
Sequence:CCGGCCATTTGCCAATAAAGACGATCTCGAGATCGTCTTTATTGGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-492s1c1
Sequence:CCGGGCGGCAGTTCTGAGTGGCAAACTCGAGTTTGCCACTCAGAACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-417s1c1
Sequence:CCGGCCCTTCTACTATGACTGGAAACTCGAGTTTCCAGTCATAGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173160.2-623s1c1
Sequence:CCGGGATGGCCTGAAGCCTAACACTCTCGAGAGTGTTAGGCTTCAGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173160
FXYD4 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-515s1c1
Sequence:CCGGCAAATGCAAGAGCAGCCAGAACTCGAGTTCTGGCTGCTCTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-396s1c1
Sequence:CCGGCCATTTGCCAATAAAGACGATCTCGAGATCGTCTTTATTGGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-492s1c1
Sequence:CCGGGCGGCAGTTCTGAGTGGCAAACTCGAGTTTGCCACTCAGAACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-417s1c1
Sequence:CCGGCCCTTCTACTATGACTGGAAACTCGAGTTTCCAGTCATAGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173160.2-623s1c1
Sequence:CCGGGATGGCCTGAAGCCTAACACTCTCGAGAGTGTTAGGCTTCAGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173160
FXYD4 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-515s1c1
Sequence:CCGGCAAATGCAAGAGCAGCCAGAACTCGAGTTCTGGCTGCTCTTGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-396s1c1
Sequence:CCGGCCATTTGCCAATAAAGACGATCTCGAGATCGTCTTTATTGGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-492s1c1
Sequence:CCGGGCGGCAGTTCTGAGTGGCAAACTCGAGTTTGCCACTCAGAACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173160.2-417s1c1
Sequence:CCGGCCCTTCTACTATGACTGGAAACTCGAGTTTCCAGTCATAGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173160.2-623s1c1
Sequence:CCGGGATGGCCTGAAGCCTAACACTCTCGAGAGTGTTAGGCTTCAGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks