EMAIL THIS PAGE TO A FRIEND

FXYD5

FXYD domain containing ion transport regulator 5

115 Gene Product Result for
Synonyms: DYSAD IWU1 KCT1 OIT2 PRO6241 RIC
UniProtKB ID: Q96DB9, B7WNZ8, Q6UW44, Q9HC34, Q9P039
Gene ID:
Human(53827) Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. This gene product, FXYD5, is a glycoprotein that functions in the up-regulation of chemokine production, and it is involved in the reduction of cell adhesion via its ability to down-regulate E-cadherin. It also promotes metastasis, and has been linked to a variety of cancers. Alternative splicing results in multiple transcript variants. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Sep 2009]
Mouse(18301) FXYD domain-containing ion transport regulator 5
Rat(60338) FXYD domain-containing ion transport regulator 5
cow(505584) FXYD domain containing ion transport regulator 5
dog(612666) FXYD domain containing ion transport regulator 5
sheep(101105940) FXYD domain containing ion transport regulator 5
naked mole-rat(101707412) FXYD domain containing ion transport regulator 5
domestic guinea pig(100719588) FXYD domain containing ion transport regulator 5
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014164 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014164 Rosetta Predictions human pricing
NM_144779 Rosetta Predictions human pricing
NM_021909 Rosetta Predictions rat pricing
NM_001111073 Rosetta Predictions mouse pricing
NM_008761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011006 predicted 374
2 SASI_Hs01_00011007 predicted 447
3 SASI_Hs01_00011009 predicted 420
4 SASI_Hs01_00011010 predicted 315
5 SASI_Hs01_00011011 predicted 315
6 SASI_Hs01_00011012 predicted 330
7 SASI_Hs01_00011013 predicted 517
8 SASI_Hs02_00345153 predicted 479
9 SASI_Hs01_00011014 predicted 342
10 SASI_Hs01_00011015 predicted 527
11 SASI_Hs01_00011008 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047155 predicted 1111
2 SASI_Hs01_00047156 predicted 1192
3 SASI_Hs01_00047158 predicted 1162
4 SASI_Hs01_00047159 predicted 1059
5 SASI_Hs01_00047160 predicted 1065
6 SASI_Hs01_00047161 predicted 1074
7 SASI_Hs01_00047162 predicted 1261
8 SASI_Hs02_00364726 predicted 1225
9 SASI_Hs01_00047163 predicted 1082
10 SASI_Hs01_00047164 predicted 1269
11 SASI_Hs01_00047157 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065260 predicted 491
2 SASI_Rn01_00065261 predicted 422
3 SASI_Rn01_00065262 predicted 612
4 SASI_Rn01_00065264 predicted 251
5 SASI_Rn01_00065265 predicted 426
6 SASI_Rn02_00262902 predicted 248
7 SASI_Rn01_00065267 predicted 416
8 SASI_Rn01_00065268 predicted 397
9 SASI_Rn01_00065269 predicted 627
10 SASI_Rn02_00262903 predicted 378
11 SASI_Rn01_00065263 predicted 524
12 SASI_Rn01_00065266 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306315 predicted 825
2 SASI_Mm02_00306316 predicted 812
3 SASI_Mm02_00306317 predicted 760
4 SASI_Mm02_00306318 predicted 844
5 SASI_Mm02_00306319 predicted 731
6 SASI_Mm02_00306320 predicted 851
7 SASI_Mm02_00306321 predicted 821
8 SASI_Mm02_00306322 predicted 618
9 SASI_Mm02_00306323 predicted 677
10 SASI_Mm02_00306324 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159277 predicted 699
2 SASI_Mm01_00159278 predicted 681
3 SASI_Mm01_00159279 predicted 630
4 SASI_Mm01_00159280 predicted 722
5 SASI_Mm01_00159281 predicted 605
6 SASI_Mm01_00159282 predicted 722
7 SASI_Mm01_00159283 predicted 692
8 SASI_Mm01_00159284 predicted 492
9 SASI_Mm01_00159285 predicted 546
10 SASI_Mm01_00159286 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008761
VALIDATED
FXYD5 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-623s1c1
Sequence:CCGGCCTCCAAACTACACCAACTCACTCGAGTGAGTTGGTGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008761.2-76s1c1
Sequence:CCGGCTCACTATTGTCGCCCTGATTCTCGAGAATCAGGGCGACAATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-502s1c1
Sequence:CCGGGTGCTGTTCATCACGGGAATTCTCGAGAATTCCCGTGATGAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008761.2-515s1c1
Sequence:CCGGCGGGAATTATCATTCTCACTACTCGAGTAGTGAGAATGATAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-327s1c1
Sequence:CCGGGCCACATACAAGCAGCAAGAACTCGAGTTCTTGCTGCTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-808s21c1
Sequence:CCGGCCTCCAAACTACACCAACTCACTCGAGTGAGTTGGTGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-583s21c1
Sequence:CCGGTCATGCCTCCATCCTACATTGCTCGAGCAATGTAGGATGGAGGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-343s21c1
Sequence:CCGGCTGCGACTACTCGTGACAATGCTCGAGCATTGTCACGAGTAGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-728s21c1
Sequence:CCGGGTGTAGGCAGTTGTCTCAATTCTCGAGAATTGAGACAACTGCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-687s21c1
Sequence:CCGGGTGCTGTTCATCACGGGAATTCTCGAGAATTCCCGTGATGAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008761
VALIDATED
FXYD5 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-623s1c1
Sequence:CCGGCCTCCAAACTACACCAACTCACTCGAGTGAGTTGGTGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008761.2-76s1c1
Sequence:CCGGCTCACTATTGTCGCCCTGATTCTCGAGAATCAGGGCGACAATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-502s1c1
Sequence:CCGGGTGCTGTTCATCACGGGAATTCTCGAGAATTCCCGTGATGAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008761.2-515s1c1
Sequence:CCGGCGGGAATTATCATTCTCACTACTCGAGTAGTGAGAATGATAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-327s1c1
Sequence:CCGGGCCACATACAAGCAGCAAGAACTCGAGTTCTTGCTGCTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-808s21c1
Sequence:CCGGCCTCCAAACTACACCAACTCACTCGAGTGAGTTGGTGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-583s21c1
Sequence:CCGGTCATGCCTCCATCCTACATTGCTCGAGCAATGTAGGATGGAGGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-343s21c1
Sequence:CCGGCTGCGACTACTCGTGACAATGCTCGAGCATTGTCACGAGTAGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-728s21c1
Sequence:CCGGGTGTAGGCAGTTGTCTCAATTCTCGAGAATTGAGACAACTGCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-687s21c1
Sequence:CCGGGTGCTGTTCATCACGGGAATTCTCGAGAATTCCCGTGATGAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008761
VALIDATED
FXYD5 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-623s1c1
Sequence:CCGGCCTCCAAACTACACCAACTCACTCGAGTGAGTTGGTGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008761.2-76s1c1
Sequence:CCGGCTCACTATTGTCGCCCTGATTCTCGAGAATCAGGGCGACAATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-502s1c1
Sequence:CCGGGTGCTGTTCATCACGGGAATTCTCGAGAATTCCCGTGATGAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008761.2-515s1c1
Sequence:CCGGCGGGAATTATCATTCTCACTACTCGAGTAGTGAGAATGATAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008761.2-327s1c1
Sequence:CCGGGCCACATACAAGCAGCAAGAACTCGAGTTCTTGCTGCTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-808s21c1
Sequence:CCGGCCTCCAAACTACACCAACTCACTCGAGTGAGTTGGTGTAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-583s21c1
Sequence:CCGGTCATGCCTCCATCCTACATTGCTCGAGCAATGTAGGATGGAGGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-343s21c1
Sequence:CCGGCTGCGACTACTCGTGACAATGCTCGAGCATTGTCACGAGTAGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-728s21c1
Sequence:CCGGGTGTAGGCAGTTGTCTCAATTCTCGAGAATTGAGACAACTGCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008761.3-687s21c1
Sequence:CCGGGTGCTGTTCATCACGGGAATTCTCGAGAATTCCCGTGATGAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014164
VALIDATED
FXYD5 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-242s1c1
Sequence:CCGGGACTCAACTATCATGGACATTCTCGAGAATGTCCATGATAGTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-410s1c1
Sequence:CCGGGAGACACACAAGAGCACCAAACTCGAGTTTGGTGCTCTTGTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-210s1c1
Sequence:CCGGCGTTGAAAGATACCACGTCCACTCGAGTGGACGTGGTATCTTTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-651s1c1
Sequence:CCGGCCCGGTTATGCCGGAATCGTTCTCGAGAACGATTCCGGCATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-543s1c1
Sequence:CCGGCCTTCTTCTATGATGAACACACTCGAGTGTGTTCATCATAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014164.4-487s21c1
Sequence:CCGGCCTTCTTCTATGATGAACACACTCGAGTGTGTTCATCATAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-354s21c1
Sequence:CCGGGAGACACACAAGAGCACCAAACTCGAGTTTGGTGCTCTTGTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-115s21c1
Sequence:CCGGTCACCATCGTTGGCCTGATTCCTCGAGGAATCAGGCCAACGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-154s21c1
Sequence:CCGGCGTTGAAAGATACCACGTCCACTCGAGTGGACGTGGTATCTTTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014164.4-632s21c1
Sequence:CCGGGAAACAGGAGCTGACAACCTGCTCGAGCAGGTTGTCAGCTCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014164
VALIDATED
FXYD5 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-242s1c1
Sequence:CCGGGACTCAACTATCATGGACATTCTCGAGAATGTCCATGATAGTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-410s1c1
Sequence:CCGGGAGACACACAAGAGCACCAAACTCGAGTTTGGTGCTCTTGTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-210s1c1
Sequence:CCGGCGTTGAAAGATACCACGTCCACTCGAGTGGACGTGGTATCTTTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-651s1c1
Sequence:CCGGCCCGGTTATGCCGGAATCGTTCTCGAGAACGATTCCGGCATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-543s1c1
Sequence:CCGGCCTTCTTCTATGATGAACACACTCGAGTGTGTTCATCATAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014164.4-487s21c1
Sequence:CCGGCCTTCTTCTATGATGAACACACTCGAGTGTGTTCATCATAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-354s21c1
Sequence:CCGGGAGACACACAAGAGCACCAAACTCGAGTTTGGTGCTCTTGTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-115s21c1
Sequence:CCGGTCACCATCGTTGGCCTGATTCCTCGAGGAATCAGGCCAACGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-154s21c1
Sequence:CCGGCGTTGAAAGATACCACGTCCACTCGAGTGGACGTGGTATCTTTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014164.4-632s21c1
Sequence:CCGGGAAACAGGAGCTGACAACCTGCTCGAGCAGGTTGTCAGCTCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014164
VALIDATED
FXYD5 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-242s1c1
Sequence:CCGGGACTCAACTATCATGGACATTCTCGAGAATGTCCATGATAGTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-410s1c1
Sequence:CCGGGAGACACACAAGAGCACCAAACTCGAGTTTGGTGCTCTTGTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-210s1c1
Sequence:CCGGCGTTGAAAGATACCACGTCCACTCGAGTGGACGTGGTATCTTTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-651s1c1
Sequence:CCGGCCCGGTTATGCCGGAATCGTTCTCGAGAACGATTCCGGCATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014164.3-543s1c1
Sequence:CCGGCCTTCTTCTATGATGAACACACTCGAGTGTGTTCATCATAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014164.4-487s21c1
Sequence:CCGGCCTTCTTCTATGATGAACACACTCGAGTGTGTTCATCATAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-354s21c1
Sequence:CCGGGAGACACACAAGAGCACCAAACTCGAGTTTGGTGCTCTTGTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-115s21c1
Sequence:CCGGTCACCATCGTTGGCCTGATTCCTCGAGGAATCAGGCCAACGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014164.4-154s21c1
Sequence:CCGGCGTTGAAAGATACCACGTCCACTCGAGTGGACGTGGTATCTTTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014164.4-632s21c1
Sequence:CCGGGAAACAGGAGCTGACAACCTGCTCGAGCAGGTTGTCAGCTCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks