EMAIL THIS PAGE TO A FRIEND

FXYD6

FXYD domain containing ion transport regulator 6

61 Gene Product Result for
UniProtKB ID: Q9H0Q3, A8K0R4, J3QLD2, Q6FIG9, Q6UW52
Gene ID:
Human(53826) Summary: This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes phosphohippolin, which likely affects the activity of Na,K-ATPase. Multiple alternatively spliced transcript variants encoding the same protein have been described. Related pseudogenes have been identified on chromosomes 10 and X. Read-through transcripts have been observed between this locus and the downstream sodium/potassium-transporting ATPase subunit gamma (FXYD2, GeneID 486) locus.[provided by RefSeq, Feb 2011]
Mouse(59095) FXYD domain-containing ion transport regulator 6
Rat(63847) FXYD domain-containing ion transport regulator 6
domestic guinea pig(100727782) FXYD domain containing ion transport regulator 6
naked mole-rat(101703520) FXYD domain containing ion transport regulator 6
sheep(101120436) FXYD domain containing ion transport regulator 6
Zebrafish(333987) FXYD domain containing ion transport regulator 6
chicken(770406) FXYD domain containing ion transport regulator 6
cow(511064) FXYD domain containing ion transport regulator 6
domestic cat(101087344) FXYD domain containing ion transport regulator 6
dog(610831) FXYD domain containing ion transport regulator 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022003 Rosetta Predictions human pricing
NM_022005 Rosetta Predictions rat pricing
NM_022004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089641 predicted 306
2 SASI_Hs01_00089644 predicted 649
3 SASI_Hs02_00355371 predicted 657
4 SASI_Hs01_00089648 predicted 640
5 SASI_Hs02_00355372 predicted 832
6 SASI_Hs02_00355373 predicted 402
7 SASI_Hs01_00089649 predicted 435
8 SASI_Hs02_00355374 predicted 664
9 SASI_Hs02_00355375 predicted 648
10 SASI_Hs02_00355376 predicted 192
11 SASI_Hs01_00089642 predicted 243
12 SASI_Hs01_00089643 predicted 640
13 SASI_Hs01_00089645 predicted 406
14 SASI_Hs01_00089646 predicted 524
15 SASI_Hs01_00089647 predicted 762
16 SASI_Hs01_00089650 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034412 predicted 726
2 SASI_Rn01_00034413 predicted 662
3 SASI_Rn01_00034414 predicted 693
4 SASI_Rn01_00034415 predicted 365
5 SASI_Rn01_00034416 predicted 663
6 SASI_Rn01_00034417 predicted 983
7 SASI_Rn01_00034418 predicted 922
8 SASI_Rn01_00034420 predicted 848
9 SASI_Rn01_00034421 predicted 391
10 SASI_Rn02_00262905 predicted 794
11 SASI_Rn01_00034419 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133173 predicted 478
2 SASI_Mm01_00133174 predicted 1071
3 SASI_Mm01_00133175 predicted 481
4 SASI_Mm02_00326477 predicted 387
5 SASI_Mm01_00133176 predicted 704
6 SASI_Mm01_00133177 predicted 645
7 SASI_Mm01_00133178 predicted 634
8 SASI_Mm01_00133179 predicted 994
9 SASI_Mm01_00133180 predicted 443
10 SASI_Mm01_00133181 predicted 687
11 SASI_Mm01_00133182 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022003
VALIDATED
FXYD6 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022003.2-1056s21c1
Sequence:CCGGGTGAACTGTGGACTCGCTTTCCTCGAGGAAAGCGAGTCCACAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022003.2-789s21c1
Sequence:CCGGGATGCAAATGTCGATGCTTAACTCGAGTTAAGCATCGACATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022003.2-615s21c1
Sequence:CCGGTAAGTCGCAGGTGCAAGTGCACTCGAGTGCACTTGCACCTGCGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022003.1-217s1c1
Sequence:CCGGGTTGGGATCCTCCTTATCCTACTCGAGTAGGATAAGGAGGATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-304s1c1
Sequence:CCGGGAGAACCTCATCACCGCCAATCTCGAGATTGGCGGTGATGAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-163s1c1
Sequence:CCGGGATTACCAGACCCTGAGGATTCTCGAGAATCCTCAGGGTCTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-248s1c1
Sequence:CCGGGCAAGTGCAGTTTCAATCAGACTCGAGTCTGATTGAAACTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-113s1c1
Sequence:CCGGTCCTGGCCAGTGCAGCTGAAACTCGAGTTTCAGCTGCACTGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022003
VALIDATED
FXYD6 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022003.2-1056s21c1
Sequence:CCGGGTGAACTGTGGACTCGCTTTCCTCGAGGAAAGCGAGTCCACAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022003.2-789s21c1
Sequence:CCGGGATGCAAATGTCGATGCTTAACTCGAGTTAAGCATCGACATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022003.2-615s21c1
Sequence:CCGGTAAGTCGCAGGTGCAAGTGCACTCGAGTGCACTTGCACCTGCGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022003.1-217s1c1
Sequence:CCGGGTTGGGATCCTCCTTATCCTACTCGAGTAGGATAAGGAGGATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-304s1c1
Sequence:CCGGGAGAACCTCATCACCGCCAATCTCGAGATTGGCGGTGATGAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-163s1c1
Sequence:CCGGGATTACCAGACCCTGAGGATTCTCGAGAATCCTCAGGGTCTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-248s1c1
Sequence:CCGGGCAAGTGCAGTTTCAATCAGACTCGAGTCTGATTGAAACTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-113s1c1
Sequence:CCGGTCCTGGCCAGTGCAGCTGAAACTCGAGTTTCAGCTGCACTGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022003
VALIDATED
FXYD6 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022003.2-1056s21c1
Sequence:CCGGGTGAACTGTGGACTCGCTTTCCTCGAGGAAAGCGAGTCCACAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022003.2-789s21c1
Sequence:CCGGGATGCAAATGTCGATGCTTAACTCGAGTTAAGCATCGACATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022003.2-615s21c1
Sequence:CCGGTAAGTCGCAGGTGCAAGTGCACTCGAGTGCACTTGCACCTGCGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022003.1-217s1c1
Sequence:CCGGGTTGGGATCCTCCTTATCCTACTCGAGTAGGATAAGGAGGATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-304s1c1
Sequence:CCGGGAGAACCTCATCACCGCCAATCTCGAGATTGGCGGTGATGAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-163s1c1
Sequence:CCGGGATTACCAGACCCTGAGGATTCTCGAGAATCCTCAGGGTCTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-248s1c1
Sequence:CCGGGCAAGTGCAGTTTCAATCAGACTCGAGTCTGATTGAAACTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022003.1-113s1c1
Sequence:CCGGTCCTGGCCAGTGCAGCTGAAACTCGAGTTTCAGCTGCACTGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022004
FXYD6 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022004.5-825s1c1
Sequence:CCGGGCTGAGAAAGTTTGTTGCTATCTCGAGATAGCAACAAACTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-216s1c1
Sequence:CCGGCGTTGGGATACTTCTCATCCTCTCGAGAGGATGAGAAGTATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-254s1c1
Sequence:CCGGGCAGTTTCAATCAGAAGCCCACTCGAGTGGGCTTCTGATTGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-152s1c1
Sequence:CCGGCTTTCTATTACGACTACCAGACTCGAGTCTGGTAGTCGTAATAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-301s1c1
Sequence:CCGGGTGGAGAACCTCATCACTACACTCGAGTGTAGTGATGAGGTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022004
FXYD6 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022004.5-825s1c1
Sequence:CCGGGCTGAGAAAGTTTGTTGCTATCTCGAGATAGCAACAAACTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-216s1c1
Sequence:CCGGCGTTGGGATACTTCTCATCCTCTCGAGAGGATGAGAAGTATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-254s1c1
Sequence:CCGGGCAGTTTCAATCAGAAGCCCACTCGAGTGGGCTTCTGATTGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-152s1c1
Sequence:CCGGCTTTCTATTACGACTACCAGACTCGAGTCTGGTAGTCGTAATAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-301s1c1
Sequence:CCGGGTGGAGAACCTCATCACTACACTCGAGTGTAGTGATGAGGTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022004
FXYD6 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022004.5-825s1c1
Sequence:CCGGGCTGAGAAAGTTTGTTGCTATCTCGAGATAGCAACAAACTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-216s1c1
Sequence:CCGGCGTTGGGATACTTCTCATCCTCTCGAGAGGATGAGAAGTATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-254s1c1
Sequence:CCGGGCAGTTTCAATCAGAAGCCCACTCGAGTGGGCTTCTGATTGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-152s1c1
Sequence:CCGGCTTTCTATTACGACTACCAGACTCGAGTCTGGTAGTCGTAATAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022004.5-301s1c1
Sequence:CCGGGTGGAGAACCTCATCACTACACTCGAGTGTAGTGATGAGGTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks