EMAIL THIS PAGE TO A FRIEND

FXYD6P3

FXYD domain containing ion transport regulator 6 pseudogene 3

10 Gene Product Result for
Synonyms: FXYD8
Species: Human FXYD6P3(406875)
UniProtKB ID: P58550, Q5JTT7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099278 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099278 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320347 predicted 231
2 SASI_Hs02_00320348 predicted 548
3 SASI_Hs02_00320349 predicted 707
4 SASI_Hs02_00320350 predicted 269
5 SASI_Hs02_00320351 predicted 491
6 SASI_Hs02_00320352 predicted 710
7 SASI_Hs02_00320353 predicted 545
8 SASI_Hs02_00320354 predicted 466
9 SASI_Hs02_00320355 predicted 609
10 SASI_Hs02_00320356 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099278
FXYD6P3 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 6 pseudogene 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-180s21c1
Sequence:CCGGTCCGAGCTGCCATCTTCTAAGCTCGAGCTTAGAAGATGGCAGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-139s21c1
Sequence:CCGGAGGATTGGAGGATTGGTATTTCTCGAGAAATACCAATCCTCCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099278.1-997s21c1
Sequence:CCGGTACTCCCTTTCATGATCATTTCTCGAGAAATGATCATGAAAGGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-91s21c1
Sequence:CCGGGCTAAGGAGAAGGAAATAGATCTCGAGATCTATTTCCTTCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099278
FXYD6P3 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 6 pseudogene 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-180s21c1
Sequence:CCGGTCCGAGCTGCCATCTTCTAAGCTCGAGCTTAGAAGATGGCAGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-139s21c1
Sequence:CCGGAGGATTGGAGGATTGGTATTTCTCGAGAAATACCAATCCTCCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099278.1-997s21c1
Sequence:CCGGTACTCCCTTTCATGATCATTTCTCGAGAAATGATCATGAAAGGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-91s21c1
Sequence:CCGGGCTAAGGAGAAGGAAATAGATCTCGAGATCTATTTCCTTCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099278
FXYD6P3 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 6 pseudogene 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-180s21c1
Sequence:CCGGTCCGAGCTGCCATCTTCTAAGCTCGAGCTTAGAAGATGGCAGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-139s21c1
Sequence:CCGGAGGATTGGAGGATTGGTATTTCTCGAGAAATACCAATCCTCCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099278.1-997s21c1
Sequence:CCGGTACTCCCTTTCATGATCATTTCTCGAGAAATGATCATGAAAGGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099278.1-91s21c1
Sequence:CCGGGCTAAGGAGAAGGAAATAGATCTCGAGATCTATTTCCTTCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks