EMAIL THIS PAGE TO A FRIEND

FXYD7

FXYD domain containing ion transport regulator 7

89 Gene Product Result for
UniProtKB ID: P58549
Gene ID:
Human(53822) Summary: This reference sequence was derived from multiple replicate ESTs and validated by similar human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, FXYD7, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000]
Mouse(57780) FXYD domain-containing ion transport regulator 7
Rat(63848) FXYD domain-containing ion transport regulator 7
domestic cat(101088634) FXYD domain containing ion transport regulator 7
cow(616128) FXYD domain containing ion transport regulator 7
naked mole-rat(101706549) FXYD domain containing ion transport regulator 7
domestic guinea pig(100724180) FXYD domain containing ion transport regulator 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU001001 MISSION® esiRNA esiRNA targeting mouse Fxyd7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022006 Rosetta Predictions human pricing
NM_022008 Rosetta Predictions rat pricing
NM_022007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137291 predicted 478
2 SASI_Hs01_00137292 predicted 476
3 SASI_Hs01_00137293 predicted 462
4 SASI_Hs01_00137295 predicted 659
5 SASI_Hs02_00355377 predicted 100
6 SASI_Hs02_00355378 predicted 114
7 SASI_Hs02_00355379 predicted 661
8 SASI_Hs02_00355380 predicted 165
9 SASI_Hs01_00137296 predicted 661
10 SASI_Hs01_00137298 predicted 267
11 SASI_Hs01_00137294 predicted 482
12 SASI_Hs01_00137297 predicted 552
13 SASI_Hs01_00137299 predicted 316
14 SASI_Hs01_00137300 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033938 predicted 260
2 SASI_Rn01_00033939 predicted 270
3 SASI_Rn01_00033940 predicted 313
4 SASI_Rn01_00033941 predicted 430
5 SASI_Rn01_00033942 predicted 430
6 SASI_Rn01_00033943 predicted 255
7 SASI_Rn01_00033944 predicted 442
8 SASI_Rn01_00033945 predicted 311
9 SASI_Rn01_00033946 predicted 423
10 SASI_Rn01_00033947 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084825 predicted 245
2 SASI_Mm01_00084827 predicted 250
3 SASI_Mm01_00084829 predicted 231
4 SASI_Mm01_00084830 predicted 383
5 SASI_Mm01_00084831 predicted 237
6 SASI_Mm01_00084832 predicted 291
7 SASI_Mm01_00084833 predicted 348
8 SASI_Mm01_00084834 predicted 243
9 SASI_Mm02_00326478 predicted 235
10 SASI_Mm02_00326479 predicted 343
11 SASI_Mm01_00084826 predicted 309
12 SASI_Mm01_00084828 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022006
FXYD7 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022006.1-171s21c1
Sequence:CCGCCATGACTCTGGCAACCATCTTCTCGAGAAGATGGTTGCCAGAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022006.1-273s21c1
Sequence:CCGGCAAATCCTGTAAGTCTGAGCTCTCGAGAGCTCAGACTTACAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-264s1c1
Sequence:CCGGCCCAACCTGCAAATCCTGTAACTCGAGTTACAGGATTTGCAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-186s1c1
Sequence:CCGGCATCTTGTTCCTGCTGGGTATCTCGAGATACCCAGCAGGAACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-117s1c1
Sequence:CCGGTCCTGAGGAACCTGACCCATTCTCGAGAATGGGTCAGGTTCCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-281s1c1
Sequence:CCGGGTAAGTCTGAGCTTCCCTCTTCTCGAGAAGAGGGAAGCTCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-141s1c1
Sequence:CCGGCTATGACTACAACACGGTGCACTCGAGTGCACCGTGTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022006
FXYD7 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022006.1-171s21c1
Sequence:CCGCCATGACTCTGGCAACCATCTTCTCGAGAAGATGGTTGCCAGAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022006.1-273s21c1
Sequence:CCGGCAAATCCTGTAAGTCTGAGCTCTCGAGAGCTCAGACTTACAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-264s1c1
Sequence:CCGGCCCAACCTGCAAATCCTGTAACTCGAGTTACAGGATTTGCAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-186s1c1
Sequence:CCGGCATCTTGTTCCTGCTGGGTATCTCGAGATACCCAGCAGGAACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-117s1c1
Sequence:CCGGTCCTGAGGAACCTGACCCATTCTCGAGAATGGGTCAGGTTCCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-281s1c1
Sequence:CCGGGTAAGTCTGAGCTTCCCTCTTCTCGAGAAGAGGGAAGCTCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-141s1c1
Sequence:CCGGCTATGACTACAACACGGTGCACTCGAGTGCACCGTGTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022006
FXYD7 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022006.1-171s21c1
Sequence:CCGCCATGACTCTGGCAACCATCTTCTCGAGAAGATGGTTGCCAGAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022006.1-273s21c1
Sequence:CCGGCAAATCCTGTAAGTCTGAGCTCTCGAGAGCTCAGACTTACAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-264s1c1
Sequence:CCGGCCCAACCTGCAAATCCTGTAACTCGAGTTACAGGATTTGCAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-186s1c1
Sequence:CCGGCATCTTGTTCCTGCTGGGTATCTCGAGATACCCAGCAGGAACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-117s1c1
Sequence:CCGGTCCTGAGGAACCTGACCCATTCTCGAGAATGGGTCAGGTTCCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-281s1c1
Sequence:CCGGGTAAGTCTGAGCTTCCCTCTTCTCGAGAAGAGGGAAGCTCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022006.1-141s1c1
Sequence:CCGGCTATGACTACAACACGGTGCACTCGAGTGCACCGTGTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022007
FXYD7 MISSION shRNA Bacterial Glycerol Stock
FXYD domain containing ion transport regulator 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022007.1-475s1c1
Sequence:CCGGCCTTGGCAACAACGATCCTATCTCGAGATAGGATCGTTGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-191s1c1
Sequence:CCGGCATCATCATCCTGAGCAAGAACTCGAGTTCTTGCTCAGGATGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-235s1c1
Sequence:CCGGCCAGGTCTGAGAGCCCAACATCTCGAGATGTTGGGCTCTCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-125s1c1
Sequence:CCGGCTATGACTATGCCACTGTGCACTCGAGTGCACAGTGGCATAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-247s1c1
Sequence:CCGGGCCCAACATGCAAATCCTGTACTCGAGTACAGGATTTGCATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022007
FXYD7 MISSION shRNA shRNA Plasmid DNA
FXYD domain containing ion transport regulator 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022007.1-475s1c1
Sequence:CCGGCCTTGGCAACAACGATCCTATCTCGAGATAGGATCGTTGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-191s1c1
Sequence:CCGGCATCATCATCCTGAGCAAGAACTCGAGTTCTTGCTCAGGATGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-235s1c1
Sequence:CCGGCCAGGTCTGAGAGCCCAACATCTCGAGATGTTGGGCTCTCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-125s1c1
Sequence:CCGGCTATGACTATGCCACTGTGCACTCGAGTGCACAGTGGCATAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-247s1c1
Sequence:CCGGGCCCAACATGCAAATCCTGTACTCGAGTACAGGATTTGCATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022007
FXYD7 MISSION shRNA Lentiviral Transduction Particles
FXYD domain containing ion transport regulator 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022007.1-475s1c1
Sequence:CCGGCCTTGGCAACAACGATCCTATCTCGAGATAGGATCGTTGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-191s1c1
Sequence:CCGGCATCATCATCCTGAGCAAGAACTCGAGTTCTTGCTCAGGATGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-235s1c1
Sequence:CCGGCCAGGTCTGAGAGCCCAACATCTCGAGATGTTGGGCTCTCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-125s1c1
Sequence:CCGGCTATGACTATGCCACTGTGCACTCGAGTGCACAGTGGCATAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022007.1-247s1c1
Sequence:CCGGGCCCAACATGCAAATCCTGTACTCGAGTACAGGATTTGCATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks