EMAIL THIS PAGE TO A FRIEND

FYB

FYN binding protein

107 Gene Product Result for
Synonyms: ADAP PRO0823 SLAP-130
UniProtKB ID: O15117, A8K2Y8, B4DLN2, E9PBV9, O00359, Q9NZI9
Gene ID:
Human(2533) Summary: The protein encoded by this gene is an adapter for the FYN protein and LCP2 signaling cascades in T-cells. The encoded protein is involved in platelet activation and controls the expression of interleukin-2. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(23880) FYN binding protein
Rat(499537) FYN binding protein
chicken(427448) FYN binding protein
dog(479355) FYN binding protein
Horse(100066754) FYN binding protein
cow(535347) FYN binding protein
domestic cat(101095954) FYN binding protein
domestic guinea pig(100715602) FYN binding protein
naked mole-rat(101718443) FYN binding protein
sheep(101105278) FYN binding protein
Domestic Rabbit(100350748) FYN binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001465 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001465 Rosetta Predictions human pricing
NM_199335 Rosetta Predictions human pricing
NM_001109176 Rosetta Predictions rat pricing
NM_011815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090449 predicted 1231
2 SASI_Hs01_00090450 predicted 901
3 SASI_Hs01_00090451 predicted 345
4 SASI_Hs01_00090452 predicted 336
5 SASI_Hs01_00090453 predicted 2677
6 SASI_Hs01_00090455 predicted 2646
7 SASI_Hs01_00090456 predicted 246
8 SASI_Hs01_00090457 predicted 2591
9 SASI_Hs01_00090458 predicted 675
10 SASI_Hs02_00331906 predicted 2669
11 SASI_Hs01_00090454 predicted 2703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051199 predicted 1239
2 SASI_Hs01_00051200 predicted 899
3 SASI_Hs01_00051201 predicted 338
4 SASI_Hs01_00051202 predicted 336
5 SASI_Hs01_00051203 predicted 2442
6 SASI_Hs01_00051204 predicted 2539
7 SASI_Hs02_00372766 predicted 2508
8 SASI_Hs01_00051206 predicted 245
9 SASI_Hs01_00051207 predicted 2453
10 SASI_Hs01_00051208 predicted 681
11 SASI_Hs01_00051205 predicted 2565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245870 predicted 1159
2 SASI_Rn02_00245871 predicted 247
3 SASI_Rn02_00245872 predicted 301
4 SASI_Rn02_00245873 predicted 647
5 SASI_Rn02_00245874 predicted 508
6 SASI_Rn02_00245875 predicted 524
7 SASI_Rn02_00245876 predicted 624
8 SASI_Rn02_00245877 predicted 286
9 SASI_Rn02_00245878 predicted 1836
10 SASI_Rn02_00245879 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083835 predicted 1132
2 SASI_Mm01_00083836 predicted 481
3 SASI_Mm01_00083837 predicted 235
4 SASI_Mm01_00083839 predicted 440
5 SASI_Mm01_00083840 predicted 601
6 SASI_Mm01_00083841 predicted 490
7 SASI_Mm01_00083842 predicted 615
8 SASI_Mm01_00083843 predicted 1773
9 SASI_Mm02_00321509 predicted 579
10 SASI_Mm02_00321510 predicted 636
11 SASI_Mm01_00083838 predicted 366
12 SASI_Mm01_00083844 predicted 1925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011815
FYB MISSION shRNA Bacterial Glycerol Stock
FYN binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-1767s1c1
Sequence:CCGGCGGAAGAAGAACTCCCTCAATCTCGAGATTGAGGGAGTTCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-2428s1c1
Sequence:CCGGGCAGGAATGAAGAGGGCAAATCTCGAGATTTGCCCTCTTCATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-2291s1c1
Sequence:CCGGCGGTGAAATTCGAGTTCTATACTCGAGTATAGAACTCGAATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-621s1c1
Sequence:CCGGGCACAAGATACTGACTCCAAACTCGAGTTTGGAGTCAGTATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-157s1c1
Sequence:CCGGGCTCGCCTTCTGGAATACAATCTCGAGATTGTATTCCAGAAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011815
FYB MISSION shRNA shRNA Plasmid DNA
FYN binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-1767s1c1
Sequence:CCGGCGGAAGAAGAACTCCCTCAATCTCGAGATTGAGGGAGTTCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-2428s1c1
Sequence:CCGGGCAGGAATGAAGAGGGCAAATCTCGAGATTTGCCCTCTTCATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-2291s1c1
Sequence:CCGGCGGTGAAATTCGAGTTCTATACTCGAGTATAGAACTCGAATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-621s1c1
Sequence:CCGGGCACAAGATACTGACTCCAAACTCGAGTTTGGAGTCAGTATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-157s1c1
Sequence:CCGGGCTCGCCTTCTGGAATACAATCTCGAGATTGTATTCCAGAAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011815
FYB MISSION shRNA Lentiviral Transduction Particles
FYN binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-1767s1c1
Sequence:CCGGCGGAAGAAGAACTCCCTCAATCTCGAGATTGAGGGAGTTCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-2428s1c1
Sequence:CCGGGCAGGAATGAAGAGGGCAAATCTCGAGATTTGCCCTCTTCATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-2291s1c1
Sequence:CCGGCGGTGAAATTCGAGTTCTATACTCGAGTATAGAACTCGAATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-621s1c1
Sequence:CCGGGCACAAGATACTGACTCCAAACTCGAGTTTGGAGTCAGTATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011815.1-157s1c1
Sequence:CCGGGCTCGCCTTCTGGAATACAATCTCGAGATTGTATTCCAGAAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001465
FYB MISSION shRNA Bacterial Glycerol Stock
FYN binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-1739s1c1
Sequence:CCGGGCTTCAAGCAAGGAGAGCAAACTCGAGTTTGCTCTCCTTGCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001465.3-3621s1c1
Sequence:CCGGGCCCTTCTCTAACAGTACATACTCGAGTATGTACTGTTAGAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-1240s1c1
Sequence:CCGGCCAAATGTTGACCTGACGAAACTCGAGTTTCGTCAGGTCAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-2014s1c1
Sequence:CCGGGATGACATTTATGATGGGATTCTCGAGAATCCCATCATAAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-1413s1c1
Sequence:CCGGCAGAAACATTAAACCTCCGTTCTCGAGAACGGAGGTTTAATGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001465.3-4222s1c1
Sequence:CCGGCCAAGATTAGATGCCACTAATCTCGAGATTAGTGGCATCTAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-1846s1c1
Sequence:CCGGGCTGTAGAGATTGACTATGATCTCGAGATCATAGTCAATCTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-2494s1c1
Sequence:CCGGGAAGTTATACAAACCACAGATCTCGAGATCTGTGGTTTGTATAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-558s1c1
Sequence:CCGGGCCATCTCTTCACAGTGTAAACTCGAGTTTACACTGTGAAGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001465
FYB MISSION shRNA shRNA Plasmid DNA
FYN binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-1739s1c1
Sequence:CCGGGCTTCAAGCAAGGAGAGCAAACTCGAGTTTGCTCTCCTTGCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001465.3-3621s1c1
Sequence:CCGGGCCCTTCTCTAACAGTACATACTCGAGTATGTACTGTTAGAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-1240s1c1
Sequence:CCGGCCAAATGTTGACCTGACGAAACTCGAGTTTCGTCAGGTCAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-2014s1c1
Sequence:CCGGGATGACATTTATGATGGGATTCTCGAGAATCCCATCATAAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-1413s1c1
Sequence:CCGGCAGAAACATTAAACCTCCGTTCTCGAGAACGGAGGTTTAATGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001465.3-4222s1c1
Sequence:CCGGCCAAGATTAGATGCCACTAATCTCGAGATTAGTGGCATCTAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-1846s1c1
Sequence:CCGGGCTGTAGAGATTGACTATGATCTCGAGATCATAGTCAATCTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-2494s1c1
Sequence:CCGGGAAGTTATACAAACCACAGATCTCGAGATCTGTGGTTTGTATAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-558s1c1
Sequence:CCGGGCCATCTCTTCACAGTGTAAACTCGAGTTTACACTGTGAAGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001465
FYB MISSION shRNA Lentiviral Transduction Particles
FYN binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-1739s1c1
Sequence:CCGGGCTTCAAGCAAGGAGAGCAAACTCGAGTTTGCTCTCCTTGCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001465.3-3621s1c1
Sequence:CCGGGCCCTTCTCTAACAGTACATACTCGAGTATGTACTGTTAGAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-1240s1c1
Sequence:CCGGCCAAATGTTGACCTGACGAAACTCGAGTTTCGTCAGGTCAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-2014s1c1
Sequence:CCGGGATGACATTTATGATGGGATTCTCGAGAATCCCATCATAAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-1413s1c1
Sequence:CCGGCAGAAACATTAAACCTCCGTTCTCGAGAACGGAGGTTTAATGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001465.3-4222s1c1
Sequence:CCGGCCAAGATTAGATGCCACTAATCTCGAGATTAGTGGCATCTAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-1846s1c1
Sequence:CCGGGCTGTAGAGATTGACTATGATCTCGAGATCATAGTCAATCTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001465.3-2494s1c1
Sequence:CCGGGAAGTTATACAAACCACAGATCTCGAGATCTGTGGTTTGTATAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001465.3-558s1c1
Sequence:CCGGGCCATCTCTTCACAGTGTAAACTCGAGTTTACACTGTGAAGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks