EMAIL THIS PAGE TO A FRIEND

FYCO1

FYVE and coiled-coil domain containing 1

113 Gene Product Result for
Synonyms: CATC2 CTRCT18 RUFY3 ZFYVE7
Gene ID:
Human(79443) Summary: This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]
Mouse(17281) FYVE and coiled-coil domain containing 1
Rat(301085) FYVE and coiled-coil domain containing 1
sheep(101104278) FYVE and coiled-coil domain containing 1
Domestic Rabbit(100349917) FYVE and coiled-coil domain containing 1
naked mole-rat(101726184) FYVE and coiled-coil domain containing 1
domestic guinea pig(100717495) FYVE and coiled-coil domain containing 1
chicken(428453) FYVE and coiled-coil domain containing 1
domestic cat(101093003) FYVE and coiled-coil domain containing 1
cow(100139246) FYVE and coiled-coil domain containing 1
Horse(100054468) FYVE and coiled-coil domain containing 1
dog(476649) FYVE and coiled-coil domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024513 Rosetta Predictions human pricing
NM_001106870 Rosetta Predictions rat pricing
NM_001110253 Rosetta Predictions mouse pricing
NM_148925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174632 predicted 834
2 SASI_Hs02_00356782 predicted 644
3 SASI_Hs02_00356783 predicted 4608
4 SASI_Hs02_00356784 predicted 3740
5 SASI_Hs01_00174633 predicted 2704
6 SASI_Hs01_00174634 predicted 251
7 SASI_Hs01_00174635 predicted 4211
8 SASI_Hs01_00174637 predicted 410
9 SASI_Hs01_00174638 predicted 881
10 SASI_Hs01_00174640 predicted 2076
11 SASI_Hs01_00174636 predicted 4294
12 SASI_Hs01_00174639 predicted 1995
13 SASI_Hs01_00174641 predicted 3382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223216 predicted 3993
2 SASI_Rn02_00223217 predicted 4405
3 SASI_Rn02_00223218 predicted 3239
4 SASI_Rn02_00223219 predicted 927
5 SASI_Rn02_00223220 predicted 4902
6 SASI_Rn02_00223221 predicted 1099
7 SASI_Rn02_00223222 predicted 4854
8 SASI_Rn02_00223223 predicted 1272
9 SASI_Rn02_00223224 predicted 4823
10 SASI_Rn02_00223225 predicted 2110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305176 predicted 3297
2 SASI_Mm02_00305177 predicted 1458
3 SASI_Mm02_00305178 predicted 4005
4 SASI_Mm02_00305179 predicted 650
5 SASI_Mm02_00305180 predicted 3328
6 SASI_Mm02_00305181 predicted 4014
7 SASI_Mm02_00305182 predicted 3337
8 SASI_Mm02_00305183 predicted 469
9 SASI_Mm02_00305184 predicted 823
10 SASI_Mm02_00305185 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120210 predicted 3552
2 SASI_Mm01_00120211 predicted 1702
3 SASI_Mm01_00120212 predicted 4245
4 SASI_Mm01_00120214 predicted 899
5 SASI_Mm01_00120215 predicted 3572
6 SASI_Mm01_00120216 predicted 4268
7 SASI_Mm02_00342723 predicted 3579
8 SASI_Mm01_00120217 predicted 716
9 SASI_Mm01_00120218 predicted 1072
10 SASI_Mm02_00342724 predicted 1768
11 SASI_Mm01_00120213 predicted 1024
12 SASI_Mm01_00120219 predicted 3851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148925
VALIDATED
FYCO1 MISSION shRNA Bacterial Glycerol Stock
FYVE and coiled-coil domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148925.1-5800s1c1
Sequence:CCGGGCAACCTTTCTATGAAAGAAACTCGAGTTTCTTTCATAGAAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148925.1-5796s1c1
Sequence:CCGGCCCTGCAACCTTTCTATGAAACTCGAGTTTCATAGAAAGGTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148925.1-2068s1c1
Sequence:CCGGCGGGAAGAACAGGTAAACAATCTCGAGATTGTTTACCTGTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148925.1-1023s1c1
Sequence:CCGGCCTGAATTGTTCTCTAAACAACTCGAGTTGTTTAGAGAACAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148925.1-601s1c1
Sequence:CCGGGCCAAGGTGAAAGGAGCAAATCTCGAGATTTGCTCCTTTCACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148925
VALIDATED
FYCO1 MISSION shRNA shRNA Plasmid DNA
FYVE and coiled-coil domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148925.1-5800s1c1
Sequence:CCGGGCAACCTTTCTATGAAAGAAACTCGAGTTTCTTTCATAGAAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148925.1-5796s1c1
Sequence:CCGGCCCTGCAACCTTTCTATGAAACTCGAGTTTCATAGAAAGGTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148925.1-2068s1c1
Sequence:CCGGCGGGAAGAACAGGTAAACAATCTCGAGATTGTTTACCTGTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148925.1-1023s1c1
Sequence:CCGGCCTGAATTGTTCTCTAAACAACTCGAGTTGTTTAGAGAACAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148925.1-601s1c1
Sequence:CCGGGCCAAGGTGAAAGGAGCAAATCTCGAGATTTGCTCCTTTCACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148925
VALIDATED
FYCO1 MISSION shRNA Lentiviral Transduction Particles
FYVE and coiled-coil domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148925.1-5800s1c1
Sequence:CCGGGCAACCTTTCTATGAAAGAAACTCGAGTTTCTTTCATAGAAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148925.1-5796s1c1
Sequence:CCGGCCCTGCAACCTTTCTATGAAACTCGAGTTTCATAGAAAGGTTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148925.1-2068s1c1
Sequence:CCGGCGGGAAGAACAGGTAAACAATCTCGAGATTGTTTACCTGTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148925.1-1023s1c1
Sequence:CCGGCCTGAATTGTTCTCTAAACAACTCGAGTTGTTTAGAGAACAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148925.1-601s1c1
Sequence:CCGGGCCAAGGTGAAAGGAGCAAATCTCGAGATTTGCTCCTTTCACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024513
FYCO1 MISSION shRNA Bacterial Glycerol Stock
FYVE and coiled-coil domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-229s1c1
Sequence:CCGGCCAGAGAATCATCCGAGACTTCTCGAGAAGTCTCGGATGATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-257s1c1
Sequence:CCGGGCTGTGACAGAACTAAGCAAACTCGAGTTTGCTTAGTTCTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-1262s1c1
Sequence:CCGGCGGGACTCACTGGACAAGAAACTCGAGTTTCTTGTCCAGTGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-3447s1c1
Sequence:CCGGCCCTGCGTGAAGACCTAGAAACTCGAGTTTCTAGGTCTTCACGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-4393s1c1
Sequence:CCGGCATCTCCTTCAGTGTGGTCTTCTCGAGAAGACCACACTGAAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024513.2-3242s21c1
Sequence:CCGGGGACTACCAGAGCAGACTTAACTCGAGTTAAGTCTGCTCTGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024513.2-4616s21c1
Sequence:CCCGGATCTACGATGGAAGTGATTTCTCGAGAAATCACTTCCATCGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024513
FYCO1 MISSION shRNA shRNA Plasmid DNA
FYVE and coiled-coil domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-229s1c1
Sequence:CCGGCCAGAGAATCATCCGAGACTTCTCGAGAAGTCTCGGATGATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-257s1c1
Sequence:CCGGGCTGTGACAGAACTAAGCAAACTCGAGTTTGCTTAGTTCTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-1262s1c1
Sequence:CCGGCGGGACTCACTGGACAAGAAACTCGAGTTTCTTGTCCAGTGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-3447s1c1
Sequence:CCGGCCCTGCGTGAAGACCTAGAAACTCGAGTTTCTAGGTCTTCACGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-4393s1c1
Sequence:CCGGCATCTCCTTCAGTGTGGTCTTCTCGAGAAGACCACACTGAAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024513.2-3242s21c1
Sequence:CCGGGGACTACCAGAGCAGACTTAACTCGAGTTAAGTCTGCTCTGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024513.2-4616s21c1
Sequence:CCCGGATCTACGATGGAAGTGATTTCTCGAGAAATCACTTCCATCGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024513
FYCO1 MISSION shRNA Lentiviral Transduction Particles
FYVE and coiled-coil domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-229s1c1
Sequence:CCGGCCAGAGAATCATCCGAGACTTCTCGAGAAGTCTCGGATGATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-257s1c1
Sequence:CCGGGCTGTGACAGAACTAAGCAAACTCGAGTTTGCTTAGTTCTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-1262s1c1
Sequence:CCGGCGGGACTCACTGGACAAGAAACTCGAGTTTCTTGTCCAGTGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-3447s1c1
Sequence:CCGGCCCTGCGTGAAGACCTAGAAACTCGAGTTTCTAGGTCTTCACGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024513.1-4393s1c1
Sequence:CCGGCATCTCCTTCAGTGTGGTCTTCTCGAGAAGACCACACTGAAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024513.2-3242s21c1
Sequence:CCGGGGACTACCAGAGCAGACTTAACTCGAGTTAAGTCTGCTCTGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024513.2-4616s21c1
Sequence:CCCGGATCTACGATGGAAGTGATTTCTCGAGAAATCACTTCCATCGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks