EMAIL THIS PAGE TO A FRIEND

FYN

FYN oncogene related to SRC, FGR, YES

170 Gene Product Result for
Synonyms: SLK SYN p59-FYN
Gene ID:
Human(2534) Summary: This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq, Jul 2008]
Mouse(14360) Fyn proto-oncogene
Rat(25150) FYN oncogene related to SRC, FGR, YES
chicken(396294) FYN oncogene related to SRC, FGR, YES
domestic cat(101085720) FYN oncogene related to SRC, FGR, YES
cow(527263) FYN oncogene related to SRC, FGR, YES
dog(475032) FYN oncogene related to SRC, FGR, YES
domestic guinea pig(100728124) FYN oncogene related to SRC, FGR, YES
naked mole-rat(101721279) FYN oncogene related to SRC, FGR, YES
sheep(101109363) FYN oncogene related to SRC, FGR, YES
Domestic Rabbit(100339741) FYN oncogene related to SRC, FGR, YES
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F7180 Anti-FYN (21-35) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500435 Anti-FYN antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
SAB2108139 Anti-FYN antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, human, horse, mouse, canine, rat, bovine, pig
western blot pricing
HPA023887 Anti-FYN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100865 Anti-FYN antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, horse, pig, rat, chicken, human, rabbit, bovine, mouse
western blot pricing
HPA063770 Anti-FYN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4501050 Anti-FYN, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB1304731 ANTI-MOUSE FYN (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4503872 Anti-phospho-Fyn (pTyr530) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301504 Anti-phospho-Fyn (pTyr530) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
WH0002534M3 Monoclonal Anti-FYN antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403844 Monoclonal Anti-FYN antibody produced in mouse clone 3G11-F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
P2992 Monoclonal Anti-p59fyn antibody produced in mouse ~1 mg/mL, clone 1S, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0965 Phosphotyrosine FYN / Tyrosine-protein Kinase Fyn ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0573 AQUA Peptide TEDDLSFH[K] human, mouse pricing
AQ0425 AQUA Peptide GSLLDFL[K] human, mouse, rat pricing
AQ0427 AQUA Peptide LIEDNEYTA[R] human, mouse, rat pricing
AQ0572 AQUA Peptide SANILVGNGLIC[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002037 siRNAs that have been validated in the lab human pricing
NM_153047 siRNAs that have been validated in the lab human pricing
NM_153048 siRNAs that have been validated in the lab human pricing
NM_012755 Rosetta Predictions rat pricing
NM_001122892 Rosetta Predictions mouse pricing
NM_001122893 Rosetta Predictions mouse pricing
NM_008054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002037 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195123 validated 1742
1 SASI_Hs01_00195124 validated 1743
2 SASI_Hs01_00195125 predicted 1972
3 SASI_Hs01_00195127 predicted 2300
4 SASI_Hs02_00333066 predicted 1658
5 SASI_Hs01_00195128 predicted 2163
6 SASI_Hs01_00195129 predicted 1723
7 SASI_Hs01_00195130 predicted 1714
8 SASI_Hs01_00195131 predicted 1808
9 SASI_Hs01_00195132 predicted 769
10 SASI_Hs01_00195126 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153047 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062523 validated 1174
2 SASI_Hs01_00062522 predicted 1161
3 SASI_Hs01_00062524 predicted 1392
4 SASI_Hs01_00062526 predicted 1725
5 SASI_Hs02_00367003 predicted 1078
6 SASI_Hs01_00062527 predicted 1586
7 SASI_Hs01_00062528 predicted 1147
8 SASI_Hs01_00062529 predicted 1138
9 SASI_Hs01_00062530 predicted 1235
10 SASI_Hs01_00062531 predicted 203
11 SASI_Hs01_00062525 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153048 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095289 validated 1053
2 SASI_Hs01_00095288 predicted 1047
3 SASI_Hs01_00095290 predicted 1277
4 SASI_Hs01_00095292 predicted 1608
5 SASI_Hs02_00367004 predicted 964
6 SASI_Hs01_00095293 predicted 1467
7 SASI_Hs01_00095294 predicted 1038
8 SASI_Hs01_00095295 predicted 1021
9 SASI_Hs01_00095296 predicted 1120
10 SASI_Hs01_00095297 predicted 246
11 SASI_Hs01_00095291 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110091 predicted 1032
2 SASI_Rn01_00110092 predicted 1467
3 SASI_Rn01_00110093 predicted 1266
4 SASI_Rn01_00110094 predicted 900
5 SASI_Rn01_00110095 predicted 952
6 SASI_Rn01_00110096 predicted 1394
7 SASI_Rn01_00110098 predicted 625
8 SASI_Rn01_00110099 predicted 1363
9 SASI_Rn01_00110100 predicted 424
10 SASI_Rn02_00260116 predicted 246
11 SASI_Rn01_00110097 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309539 predicted 2131
2 SASI_Mm02_00309540 predicted 847
3 SASI_Mm02_00309541 predicted 1597
4 SASI_Mm02_00309542 predicted 1671
5 SASI_Mm02_00309543 predicted 919
6 SASI_Mm02_00309544 predicted 1826
7 SASI_Mm02_00309545 predicted 1904
8 SASI_Mm02_00309546 predicted 640
9 SASI_Mm02_00309547 predicted 1565
10 SASI_Mm02_00309548 predicted 2017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309549 predicted 2206
2 SASI_Mm02_00309550 predicted 912
3 SASI_Mm02_00309551 predicted 1679
4 SASI_Mm02_00309552 predicted 1741
5 SASI_Mm02_00309553 predicted 983
6 SASI_Mm02_00309554 predicted 1904
7 SASI_Mm02_00309555 predicted 1984
8 SASI_Mm02_00309556 predicted 710
9 SASI_Mm02_00309557 predicted 1651
10 SASI_Mm02_00309558 predicted 2091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313032 predicted 2196
2 SASI_Mm01_00126274 predicted 916
3 SASI_Mm02_00313033 predicted 1671
4 SASI_Mm01_00126279 predicted 1736
5 SASI_Mm02_00313034 predicted 985
6 SASI_Mm02_00313035 predicted 1894
7 SASI_Mm02_00313036 predicted 1978
8 SASI_Mm01_00126281 predicted 704
9 SASI_Mm02_00313037 predicted 1639
10 SASI_Mm02_00313038 predicted 2088
11 SASI_Mm01_00126273 predicted 853
12 SASI_Mm01_00126275 predicted 982
13 SASI_Mm01_00126276 predicted 909
14 SASI_Mm01_00126277 predicted 1260
15 SASI_Mm01_00126278 predicted 1103
16 SASI_Mm01_00126280 predicted 633
17 SASI_Mm01_00126282 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002037
VALIDATED
FYN MISSION shRNA Bacterial Glycerol Stock
FYN oncogene related to SRC, FGR, YES
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002037.3-2328s21c1
Sequence:GTACCGGGAACTTCCATGGCCCTCATTACTCGAGTAATGAGGGCCATGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1805s21c1
Sequence:CCGGTCGGATTGGCCCGATTGATAGCTCGAGCTATCAATCGGGCCAATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1251s21c1
Sequence:CCGGTCAGCAGCTTGTACAACATTACTCGAGTAATGTTGTACAAGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-777s21c1
Sequence:CCGGTGTGAACTCTTCGTCTCATACCTCGAGGTATGAGACGAAGAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1719s21c1
Sequence:CCGGCATCGAGCGCATGAATTATATCTCGAGATATAATTCATGCGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002037.3-2389s21c1
Sequence:CCGGTTCGAGACAGAACCTTGTTATCTCGAGATAACAAGGTTCTGTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-970s21c1
Sequence:GTACCGGGGTTACATTCCCAGCAATTATCTCGAGATAATTGCTGGGAATGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002037.x-1476s1c1
Sequence:CCGGGACTCTTAAACCAGGCACAATCTCGAGATTGTGCCTGGTTTAAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002037.x-1129s1c1
Sequence:CCGGGCCTATTCACTTTCTATCCGTCTCGAGACGGATAGAAAGTGAATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002037.x-1336s1c1
Sequence:CCGGCTTACCGATCTGTCTGTCAAACTCGAGTTTGACAGACAGATCGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002037.x-2488s1c1
Sequence:CCGGGTGCCAACAATCCTAGTGCTTCTCGAGAAGCACTAGGATTGTTGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-821s1c1
Sequence:CCGGGAACAGGAGTGACACTCTTTGCTCGAGCAAAGAGTGTCACTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-1725s1c1
Sequence:CCGGGCGCATGAATTATATCCATAGCTCGAGCTATGGATATAATTCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-959s1c1
Sequence:CCGGCTGGAGAGACAGGTTACATTCCTCGAGGAATGTAACCTGTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002037
VALIDATED
FYN MISSION shRNA shRNA Plasmid DNA
FYN oncogene related to SRC, FGR, YES
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002037.3-2328s21c1
Sequence:GTACCGGGAACTTCCATGGCCCTCATTACTCGAGTAATGAGGGCCATGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1805s21c1
Sequence:CCGGTCGGATTGGCCCGATTGATAGCTCGAGCTATCAATCGGGCCAATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1251s21c1
Sequence:CCGGTCAGCAGCTTGTACAACATTACTCGAGTAATGTTGTACAAGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-777s21c1
Sequence:CCGGTGTGAACTCTTCGTCTCATACCTCGAGGTATGAGACGAAGAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1719s21c1
Sequence:CCGGCATCGAGCGCATGAATTATATCTCGAGATATAATTCATGCGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002037.3-2389s21c1
Sequence:CCGGTTCGAGACAGAACCTTGTTATCTCGAGATAACAAGGTTCTGTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-970s21c1
Sequence:GTACCGGGGTTACATTCCCAGCAATTATCTCGAGATAATTGCTGGGAATGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002037.x-1476s1c1
Sequence:CCGGGACTCTTAAACCAGGCACAATCTCGAGATTGTGCCTGGTTTAAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002037.x-1129s1c1
Sequence:CCGGGCCTATTCACTTTCTATCCGTCTCGAGACGGATAGAAAGTGAATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002037.x-1336s1c1
Sequence:CCGGCTTACCGATCTGTCTGTCAAACTCGAGTTTGACAGACAGATCGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002037.x-2488s1c1
Sequence:CCGGGTGCCAACAATCCTAGTGCTTCTCGAGAAGCACTAGGATTGTTGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-821s1c1
Sequence:CCGGGAACAGGAGTGACACTCTTTGCTCGAGCAAAGAGTGTCACTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-1725s1c1
Sequence:CCGGGCGCATGAATTATATCCATAGCTCGAGCTATGGATATAATTCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-959s1c1
Sequence:CCGGCTGGAGAGACAGGTTACATTCCTCGAGGAATGTAACCTGTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002037
VALIDATED
FYN MISSION shRNA Lentiviral Transduction Particles
FYN oncogene related to SRC, FGR, YES
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002037.3-2328s21c1
Sequence:GTACCGGGAACTTCCATGGCCCTCATTACTCGAGTAATGAGGGCCATGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1805s21c1
Sequence:CCGGTCGGATTGGCCCGATTGATAGCTCGAGCTATCAATCGGGCCAATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1251s21c1
Sequence:CCGGTCAGCAGCTTGTACAACATTACTCGAGTAATGTTGTACAAGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-777s21c1
Sequence:CCGGTGTGAACTCTTCGTCTCATACCTCGAGGTATGAGACGAAGAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-1719s21c1
Sequence:CCGGCATCGAGCGCATGAATTATATCTCGAGATATAATTCATGCGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002037.3-2389s21c1
Sequence:CCGGTTCGAGACAGAACCTTGTTATCTCGAGATAACAAGGTTCTGTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002037.3-970s21c1
Sequence:GTACCGGGGTTACATTCCCAGCAATTATCTCGAGATAATTGCTGGGAATGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002037.x-1476s1c1
Sequence:CCGGGACTCTTAAACCAGGCACAATCTCGAGATTGTGCCTGGTTTAAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002037.x-1129s1c1
Sequence:CCGGGCCTATTCACTTTCTATCCGTCTCGAGACGGATAGAAAGTGAATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002037.x-1336s1c1
Sequence:CCGGCTTACCGATCTGTCTGTCAAACTCGAGTTTGACAGACAGATCGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002037.x-2488s1c1
Sequence:CCGGGTGCCAACAATCCTAGTGCTTCTCGAGAAGCACTAGGATTGTTGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-821s1c1
Sequence:CCGGGAACAGGAGTGACACTCTTTGCTCGAGCAAAGAGTGTCACTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-1725s1c1
Sequence:CCGGGCGCATGAATTATATCCATAGCTCGAGCTATGGATATAATTCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002037.3-959s1c1
Sequence:CCGGCTGGAGAGACAGGTTACATTCCTCGAGGAATGTAACCTGTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008054
VALIDATED
FYN MISSION shRNA Bacterial Glycerol Stock
FYN oncogene related to SRC, FGR, YES
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-1136s21c1
Sequence:CCGGTTGACAATGGTGGATACTATACTCGAGTATAGTATCCACCATTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-1644s21c1
Sequence:CCGGCATCGAGCGCATGAATTATATCTCGAGATATAATTCATGCGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008054.2-2307s21c1
Sequence:CCGGTCTGAGACAGAAGCGTGTTATCTCGAGATAACACGCTTCTGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008054.2-2472s21c1
Sequence:CCGGTCTTCACCTGATTCAACTAAACTCGAGTTTAGTTGAATCAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-767s21c1
Sequence:CCGGCACTGTTTGTGGCGCTTTATGCTCGAGCATAAAGCGCCACAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008054.1-1531s1c1
Sequence:CCGGCCTGTATGGAAGGTTCACAATCTCGAGATTGTGAACCTTCCATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008054.1-1298s1c1
Sequence:CCGGGCTCTGAAGTTGCCAAACCTTCTCGAGAAGGTTTGGCAACTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008054.1-364s1c1
Sequence:CCGGCATCCCGAACTACAACAACTTCTCGAGAAGTTGTTGTAGTTCGGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008054
VALIDATED
FYN MISSION shRNA shRNA Plasmid DNA
FYN oncogene related to SRC, FGR, YES
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-1136s21c1
Sequence:CCGGTTGACAATGGTGGATACTATACTCGAGTATAGTATCCACCATTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-1644s21c1
Sequence:CCGGCATCGAGCGCATGAATTATATCTCGAGATATAATTCATGCGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008054.2-2307s21c1
Sequence:CCGGTCTGAGACAGAAGCGTGTTATCTCGAGATAACACGCTTCTGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008054.2-2472s21c1
Sequence:CCGGTCTTCACCTGATTCAACTAAACTCGAGTTTAGTTGAATCAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-767s21c1
Sequence:CCGGCACTGTTTGTGGCGCTTTATGCTCGAGCATAAAGCGCCACAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008054.1-1531s1c1
Sequence:CCGGCCTGTATGGAAGGTTCACAATCTCGAGATTGTGAACCTTCCATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008054.1-1298s1c1
Sequence:CCGGGCTCTGAAGTTGCCAAACCTTCTCGAGAAGGTTTGGCAACTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008054.1-364s1c1
Sequence:CCGGCATCCCGAACTACAACAACTTCTCGAGAAGTTGTTGTAGTTCGGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008054
VALIDATED
FYN MISSION shRNA Lentiviral Transduction Particles
FYN oncogene related to SRC, FGR, YES
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-1136s21c1
Sequence:CCGGTTGACAATGGTGGATACTATACTCGAGTATAGTATCCACCATTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-1644s21c1
Sequence:CCGGCATCGAGCGCATGAATTATATCTCGAGATATAATTCATGCGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008054.2-2307s21c1
Sequence:CCGGTCTGAGACAGAAGCGTGTTATCTCGAGATAACACGCTTCTGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008054.2-2472s21c1
Sequence:CCGGTCTTCACCTGATTCAACTAAACTCGAGTTTAGTTGAATCAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008054.2-767s21c1
Sequence:CCGGCACTGTTTGTGGCGCTTTATGCTCGAGCATAAAGCGCCACAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008054.1-1531s1c1
Sequence:CCGGCCTGTATGGAAGGTTCACAATCTCGAGATTGTGAACCTTCCATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008054.1-1298s1c1
Sequence:CCGGGCTCTGAAGTTGCCAAACCTTCTCGAGAAGGTTTGGCAACTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008054.1-364s1c1
Sequence:CCGGCATCCCGAACTACAACAACTTCTCGAGAAGTTGTTGTAGTTCGGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks