EMAIL THIS PAGE TO A FRIEND

FYTTD1

forty-two-three domain containing 1

Synonyms: UIF
Gene ID:
Mouse(69823) forty-two-three domain containing 1
Rat(360726) forty-two-three domain containing 1
chicken(424921) forty-two-three domain containing 1
dog(609238) forty-two-three domain containing 1
domestic cat(101098157) forty-two-three domain containing 1
cow(407149) forty-two-three domain containing 1
sheep(101119777) forty-two-three domain containing 1
naked mole-rat(101698267) forty-two-three domain containing 1
domestic guinea pig(100724877) forty-two-three domain containing 1
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011537 Rosetta Predictions human pricing
NM_032288 Rosetta Predictions human pricing
NM_001047899 Rosetta Predictions rat pricing
XM_340998 Rosetta Predictions rat pricing
NM_027226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305971 predicted 954
2 SASI_Hs02_00305972 predicted 1187
3 SASI_Hs01_00131829 predicted 1085
4 SASI_Hs01_00131830 predicted 875
5 SASI_Hs02_00305973 predicted 953
6 SASI_Hs01_00131832 predicted 1016
7 SASI_Hs01_00131833 predicted 1126
8 SASI_Hs01_00131835 predicted 778
9 SASI_Hs01_00131836 predicted 931
10 SASI_Hs01_00131837 predicted 1164
11 SASI_Hs01_00131831 predicted 1651
12 SASI_Hs01_00131834 predicted 958
13 SASI_Hs01_00131838 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359607 predicted 787
2 SASI_Hs02_00359608 predicted 1014
3 SASI_Hs01_00238395 predicted 912
4 SASI_Hs01_00238396 predicted 705
5 SASI_Hs02_00359609 predicted 781
6 SASI_Hs01_00238398 predicted 847
7 SASI_Hs01_00238399 predicted 948
8 SASI_Hs01_00238401 predicted 604
9 SASI_Hs01_00238402 predicted 760
10 SASI_Hs01_00238403 predicted 989
11 SASI_Hs01_00238397 predicted 1474
12 SASI_Hs01_00238400 predicted 780
13 SASI_Hs01_00238404 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206607 predicted 309
2 SASI_Rn02_00206608 predicted 293
3 SASI_Rn02_00206609 predicted 344
4 SASI_Rn02_00206610 predicted 261
5 SASI_Rn02_00206611 predicted 339
6 SASI_Rn02_00206612 predicted 196
7 SASI_Rn02_00206613 predicted 215
8 SASI_Rn02_00206614 predicted 318
9 SASI_Rn02_00206615 predicted 302
10 SASI_Rn02_00206616 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190489 predicted 681
2 SASI_Rn01_00190490 predicted 378
3 SASI_Rn01_00190491 predicted 669
4 SASI_Rn01_00190492 predicted 883
5 SASI_Rn01_00190493 predicted 840
6 SASI_Rn01_00190494 predicted 1506
7 SASI_Rn01_00190495 predicted 234
8 SASI_Rn01_00190496 predicted 1392
9 SASI_Rn01_00190497 predicted 1387
10 SASI_Rn01_00190498 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085055 predicted 656
2 SASI_Mm01_00085056 predicted 872
3 SASI_Mm01_00085057 predicted 374
4 SASI_Mm02_00331788 predicted 416
5 SASI_Mm01_00085058 predicted 593
6 SASI_Mm01_00085059 predicted 1378
7 SASI_Mm02_00331789 predicted 833
8 SASI_Mm01_00085060 predicted 404
9 SASI_Mm02_00331790 predicted 524
10 SASI_Mm01_00085062 predicted 739
11 SASI_Mm01_00085054 predicted 417
12 SASI_Mm01_00085061 predicted 587
13 SASI_Mm01_00085063 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027226
FYTTD1 MISSION shRNA Bacterial Glycerol Stock
forty-two-three domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027226.2-1179s1c1
Sequence:CCGGCCTGAAAGAATAGCAGGGAATCTCGAGATTCCCTGCTATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-407s1c1
Sequence:CCGGCCTATGAATCGTCCACCTCTACTCGAGTAGAGGTGGACGATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-871s1c1
Sequence:CCGGCGTCCCTCTACAGTTTGACATCTCGAGATGTCAAACTGTAGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-720s1c1
Sequence:CCGGCCACCACAAATGGAGGAATTTCTCGAGAAATTCCTCCATTTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-874s1c1
Sequence:CCGGCCCTCTACAGTTTGACATAAACTCGAGTTTATGTCAAACTGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027226
FYTTD1 MISSION shRNA shRNA Plasmid DNA
forty-two-three domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027226.2-1179s1c1
Sequence:CCGGCCTGAAAGAATAGCAGGGAATCTCGAGATTCCCTGCTATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-407s1c1
Sequence:CCGGCCTATGAATCGTCCACCTCTACTCGAGTAGAGGTGGACGATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-871s1c1
Sequence:CCGGCGTCCCTCTACAGTTTGACATCTCGAGATGTCAAACTGTAGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-720s1c1
Sequence:CCGGCCACCACAAATGGAGGAATTTCTCGAGAAATTCCTCCATTTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-874s1c1
Sequence:CCGGCCCTCTACAGTTTGACATAAACTCGAGTTTATGTCAAACTGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027226
FYTTD1 MISSION shRNA Lentiviral Transduction Particles
forty-two-three domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027226.2-1179s1c1
Sequence:CCGGCCTGAAAGAATAGCAGGGAATCTCGAGATTCCCTGCTATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-407s1c1
Sequence:CCGGCCTATGAATCGTCCACCTCTACTCGAGTAGAGGTGGACGATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-871s1c1
Sequence:CCGGCGTCCCTCTACAGTTTGACATCTCGAGATGTCAAACTGTAGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-720s1c1
Sequence:CCGGCCACCACAAATGGAGGAATTTCTCGAGAAATTCCTCCATTTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027226.2-874s1c1
Sequence:CCGGCCCTCTACAGTTTGACATAAACTCGAGTTTATGTCAAACTGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032288
FYTTD1 MISSION shRNA Bacterial Glycerol Stock
forty-two-three domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-235s1c1
Sequence:CCGGGTTGAATCGAAAGGAAGGGAACTCGAGTTCCCTTCCTTTCGATTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-848s1c1
Sequence:CCGGGTAACTCAGAAACCACGATTACTCGAGTAATCGTGGTTTCTGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-373s1c1
Sequence:CCGGGAATCGTAGAGGAAGAGTAATCTCGAGATTACTCTTCCTCTACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-719s1c1
Sequence:CCGGGCCCAGTTGAATACAGAACAACTCGAGTTGTTCTGTATTCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-839s1c1
Sequence:CCGGCAATGCCCAGTAACTCAGAAACTCGAGTTTCTGAGTTACTGGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032288.6-858s21c1
Sequence:CCGGAGCAAAGAGAACTCGTCAATGCTCGAGCATTGACGAGTTCTCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032288.6-1528s21c1
Sequence:CCGGTAGACTTTGTCATGGTAAATCCTCGAGGATTTACCATGACAAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032288
FYTTD1 MISSION shRNA shRNA Plasmid DNA
forty-two-three domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-235s1c1
Sequence:CCGGGTTGAATCGAAAGGAAGGGAACTCGAGTTCCCTTCCTTTCGATTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-848s1c1
Sequence:CCGGGTAACTCAGAAACCACGATTACTCGAGTAATCGTGGTTTCTGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-373s1c1
Sequence:CCGGGAATCGTAGAGGAAGAGTAATCTCGAGATTACTCTTCCTCTACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-719s1c1
Sequence:CCGGGCCCAGTTGAATACAGAACAACTCGAGTTGTTCTGTATTCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-839s1c1
Sequence:CCGGCAATGCCCAGTAACTCAGAAACTCGAGTTTCTGAGTTACTGGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032288.6-858s21c1
Sequence:CCGGAGCAAAGAGAACTCGTCAATGCTCGAGCATTGACGAGTTCTCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032288.6-1528s21c1
Sequence:CCGGTAGACTTTGTCATGGTAAATCCTCGAGGATTTACCATGACAAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032288
FYTTD1 MISSION shRNA Lentiviral Transduction Particles
forty-two-three domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-235s1c1
Sequence:CCGGGTTGAATCGAAAGGAAGGGAACTCGAGTTCCCTTCCTTTCGATTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-848s1c1
Sequence:CCGGGTAACTCAGAAACCACGATTACTCGAGTAATCGTGGTTTCTGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-373s1c1
Sequence:CCGGGAATCGTAGAGGAAGAGTAATCTCGAGATTACTCTTCCTCTACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-719s1c1
Sequence:CCGGGCCCAGTTGAATACAGAACAACTCGAGTTGTTCTGTATTCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032288.4-839s1c1
Sequence:CCGGCAATGCCCAGTAACTCAGAAACTCGAGTTTCTGAGTTACTGGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032288.6-858s21c1
Sequence:CCGGAGCAAAGAGAACTCGTCAATGCTCGAGCATTGACGAGTTCTCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032288.6-1528s21c1
Sequence:CCGGTAGACTTTGTCATGGTAAATCCTCGAGGATTTACCATGACAAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks