EMAIL THIS PAGE TO A FRIEND

FZD10

frizzled family receptor 10

Synonyms: CD350 FZ-10 Fz10 FzE7 hFz10
UniProtKB ID: Q9ULW2
Gene ID:
Human(11211) Summary: This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
Mouse(93897) frizzled homolog 10 (Drosophila)
Rat(363913) frizzled family receptor 10
sheep(101118991) frizzled family receptor 10
domestic guinea pig(100731601) frizzled family receptor 10
naked mole-rat(101708392) frizzled family receptor 10
Zebrafish(30366) frizzled homolog 10
chicken(373885) frizzled family receptor 10
dog(486232) frizzled family receptor 10
cow(515323) frizzled family receptor 10
domestic cat(101081169) frizzled family receptor 10
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007197 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032521 MISSION® esiRNA esiRNA human FZD10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007197 Rosetta Predictions human pricing
XR_006619 Rosetta Predictions rat pricing
XR_009241 Rosetta Predictions rat pricing
NM_175284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026634 predicted 1854
2 SASI_Hs01_00026635 predicted 1263
3 SASI_Hs01_00026637 predicted 2564
4 SASI_Hs01_00026638 predicted 577
5 SASI_Hs01_00026639 predicted 2539
6 SASI_Hs01_00026640 predicted 1820
7 SASI_Hs01_00026642 predicted 585
8 SASI_Hs02_00343174 predicted 2511
9 SASI_Hs02_00343175 predicted 639
10 SASI_Hs02_00343176 predicted 1778
11 SASI_Hs01_00026636 predicted 2552
12 SASI_Hs01_00026641 predicted 2522
13 SASI_Hs01_00026643 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00412478 predicted 443
2 SASI_Rn01_00130973 predicted 713
3 SASI_Rn01_00130974 predicted 392
4 SASI_Rn01_00130976 predicted 565
5 SASI_Rn01_00130977 predicted 825
6 SASI_Rn01_00130978 predicted 510
7 SASI_Rn01_00130979 predicted 484
8 SASI_Rn01_00130980 predicted 820
9 SASI_Rn01_00130981 predicted 648
10 SASI_Rn01_00130982 predicted 787
11 SASI_Rn01_00130975 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194957 predicted 256
2 SASI_Rn01_00194958 predicted 813
3 SASI_Rn01_00194959 predicted 215
4 SASI_Rn01_00194960 predicted 493
5 SASI_Rn02_00419183 predicted 254
6 SASI_Rn01_00194962 predicted 668
7 SASI_Rn01_00194963 predicted 927
8 SASI_Rn01_00194964 predicted 609
9 SASI_Rn01_00194966 predicted 583
10 SASI_Rn02_00419184 predicted 923
11 SASI_Rn01_00194961 predicted 784
12 SASI_Rn01_00194965 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132980 predicted 1199
2 SASI_Mm01_00132981 predicted 1359
3 SASI_Mm01_00132982 predicted 723
4 SASI_Mm01_00132983 predicted 922
5 SASI_Mm01_00132984 predicted 920
6 SASI_Mm01_00132985 predicted 456
7 SASI_Mm01_00132986 predicted 680
8 SASI_Mm01_00132987 predicted 721
9 SASI_Mm01_00132988 predicted 1043
10 SASI_Mm01_00132989 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175284
FZD10 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175284.3-2442s1c1
Sequence:CCGGCCAGCCTTCATAGCCATGTTTCTCGAGAAACATGGCTATGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-1357s1c1
Sequence:CCGGGTCCGGCTTTGTGGCTTTATTCTCGAGAATAAAGCCACAAAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-229s1c1
Sequence:CCGGGATTCCCATGTGCAAGGACATCTCGAGATGTCCTTGCACATGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-1550s1c1
Sequence:CCGGCACAAGTGTAAGATGAACAATCTCGAGATTGTTCATCTTACACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175284.3-1045s21c1
Sequence:CCAGCTTAGTCTTCTTGGTACTTTACTCGAGTAAAGTACCAAGAAGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175284.3-1071s21c1
Sequence:CCGGTCGGCATGGCCAGCTCTTTATCTCGAGATAAAGAGCTGGCCATGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175284
FZD10 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175284.3-2442s1c1
Sequence:CCGGCCAGCCTTCATAGCCATGTTTCTCGAGAAACATGGCTATGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-1357s1c1
Sequence:CCGGGTCCGGCTTTGTGGCTTTATTCTCGAGAATAAAGCCACAAAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-229s1c1
Sequence:CCGGGATTCCCATGTGCAAGGACATCTCGAGATGTCCTTGCACATGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-1550s1c1
Sequence:CCGGCACAAGTGTAAGATGAACAATCTCGAGATTGTTCATCTTACACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175284.3-1045s21c1
Sequence:CCAGCTTAGTCTTCTTGGTACTTTACTCGAGTAAAGTACCAAGAAGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175284.3-1071s21c1
Sequence:CCGGTCGGCATGGCCAGCTCTTTATCTCGAGATAAAGAGCTGGCCATGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175284
FZD10 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175284.3-2442s1c1
Sequence:CCGGCCAGCCTTCATAGCCATGTTTCTCGAGAAACATGGCTATGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-1357s1c1
Sequence:CCGGGTCCGGCTTTGTGGCTTTATTCTCGAGAATAAAGCCACAAAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-229s1c1
Sequence:CCGGGATTCCCATGTGCAAGGACATCTCGAGATGTCCTTGCACATGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175284.3-1550s1c1
Sequence:CCGGCACAAGTGTAAGATGAACAATCTCGAGATTGTTCATCTTACACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175284.3-1045s21c1
Sequence:CCAGCTTAGTCTTCTTGGTACTTTACTCGAGTAAAGTACCAAGAAGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175284.3-1071s21c1
Sequence:CCGGTCGGCATGGCCAGCTCTTTATCTCGAGATAAAGAGCTGGCCATGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007197
FZD10 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007197.2-2774s1c1
Sequence:CCGGCCTCCATCAAACCTCACATTTCTCGAGAAATGTGAGGTTTGATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-810s1c1
Sequence:CCGGCCCGATTATGGAGCAGTTCAACTCGAGTTGAACTGCTCCATAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-1857s1c1
Sequence:CCGGCAACATGGATTACTGGAAGATCTCGAGATCTTCCAGTAATCCATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-2061s1c1
Sequence:CCGGCAGCCGTAGGTTAAAGAAGAACTCGAGTTCTTCTTTAACCTACGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-591s1c1
Sequence:CCGGCGGCTACAACATGACTCGTATCTCGAGATACGAGTCATGTTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007197.2-2536s21c1
Sequence:CCGGGTTGGCTTTGCTACCCATTTACTCGAGTAAATGGGTAGCAAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007197.2-2456s21c1
Sequence:CCGGTTGTGGTAAAGTAGTTGATTCCTCGAGGAATCAACTACTTTACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007197.2-2054s21c1
Sequence:CCGGAGGTGTGCAGCCGTAGGTTAACTCGAGTTAACCTACGGCTGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007197
FZD10 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007197.2-2774s1c1
Sequence:CCGGCCTCCATCAAACCTCACATTTCTCGAGAAATGTGAGGTTTGATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-810s1c1
Sequence:CCGGCCCGATTATGGAGCAGTTCAACTCGAGTTGAACTGCTCCATAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-1857s1c1
Sequence:CCGGCAACATGGATTACTGGAAGATCTCGAGATCTTCCAGTAATCCATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-2061s1c1
Sequence:CCGGCAGCCGTAGGTTAAAGAAGAACTCGAGTTCTTCTTTAACCTACGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-591s1c1
Sequence:CCGGCGGCTACAACATGACTCGTATCTCGAGATACGAGTCATGTTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007197.2-2536s21c1
Sequence:CCGGGTTGGCTTTGCTACCCATTTACTCGAGTAAATGGGTAGCAAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007197.2-2456s21c1
Sequence:CCGGTTGTGGTAAAGTAGTTGATTCCTCGAGGAATCAACTACTTTACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007197.2-2054s21c1
Sequence:CCGGAGGTGTGCAGCCGTAGGTTAACTCGAGTTAACCTACGGCTGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007197
FZD10 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007197.2-2774s1c1
Sequence:CCGGCCTCCATCAAACCTCACATTTCTCGAGAAATGTGAGGTTTGATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-810s1c1
Sequence:CCGGCCCGATTATGGAGCAGTTCAACTCGAGTTGAACTGCTCCATAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-1857s1c1
Sequence:CCGGCAACATGGATTACTGGAAGATCTCGAGATCTTCCAGTAATCCATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-2061s1c1
Sequence:CCGGCAGCCGTAGGTTAAAGAAGAACTCGAGTTCTTCTTTAACCTACGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007197.2-591s1c1
Sequence:CCGGCGGCTACAACATGACTCGTATCTCGAGATACGAGTCATGTTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007197.2-2536s21c1
Sequence:CCGGGTTGGCTTTGCTACCCATTTACTCGAGTAAATGGGTAGCAAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007197.2-2456s21c1
Sequence:CCGGTTGTGGTAAAGTAGTTGATTCCTCGAGGAATCAACTACTTTACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007197.2-2054s21c1
Sequence:CCGGAGGTGTGCAGCCGTAGGTTAACTCGAGTTAACCTACGGCTGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks