EMAIL THIS PAGE TO A FRIEND

FZD1

frizzled family receptor 1

87 Gene Product Result for
UniProtKB ID: Q9UP38, A4D1E8, O94815, Q549T8
Gene ID:
Human(8321) Summary: Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD1 protein contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. The FZD1 transcript is expressed in various tissues. [provided by RefSeq, Jul 2008]
Mouse(14362) frizzled homolog 1 (Drosophila)
Rat(58868) frizzled family receptor 1
Zebrafish(30365) frizzled homolog 1
chicken(374062) frizzled family receptor 1
dog(482294) frizzled family receptor 1
domestic cat(101082735) frizzled family receptor 1
Horse(100060569) frizzled family receptor 1
cow(445417) frizzled family receptor 1
domestic guinea pig(100730489) frizzled family receptor 1
sheep(101112309) frizzled family receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003505 Rosetta Predictions human pricing
NM_021266 Rosetta Predictions rat pricing
NM_021457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185158 predicted 2588
2 SASI_Hs01_00185159 predicted 2448
3 SASI_Hs01_00185160 predicted 1538
4 SASI_Hs01_00185161 predicted 1818
5 SASI_Hs01_00185162 predicted 2467
6 SASI_Hs01_00185163 predicted 2196
7 SASI_Hs01_00185164 predicted 2562
8 SASI_Hs01_00185165 predicted 888
9 SASI_Hs01_00185166 predicted 1300
10 SASI_Hs01_00185167 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048273 predicted 847
2 SASI_Rn01_00048274 predicted 2399
3 SASI_Rn01_00048275 predicted 1155
4 SASI_Rn01_00048276 predicted 458
5 SASI_Rn01_00048277 predicted 2219
6 SASI_Rn01_00048278 predicted 1238
7 SASI_Rn01_00048279 predicted 1914
8 SASI_Rn01_00048280 predicted 2333
9 SASI_Rn02_00262591 predicted 459
10 SASI_Rn02_00262592 predicted 1491
11 SASI_Rn01_00048271 predicted 1809
12 SASI_Rn01_00048272 predicted 2188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118562 predicted 1250
2 SASI_Mm02_00326107 predicted 2233
3 SASI_Mm01_00118563 predicted 681
4 SASI_Mm01_00118564 predicted 2031
5 SASI_Mm01_00118565 predicted 2558
6 SASI_Mm01_00118566 predicted 2570
7 SASI_Mm01_00118568 predicted 1345
8 SASI_Mm01_00118569 predicted 1380
9 SASI_Mm01_00118570 predicted 2109
10 SASI_Mm01_00118571 predicted 2651
11 SASI_Mm01_00118567 predicted 1698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003505
FZD1 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-1732s21c1
Sequence:CCGGTCGAAGCCAACTCACAGTATTCTCGAGAATACTGTGAGTTGGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-2209s21c1
Sequence:CCGGACTTCACGGTCTTCATGATTACTCGAGTAATCATGAAGACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-868s21c1
Sequence:CCGGAGTTCTACCCTCTAGTGAAAGCTCGAGCTTTCACTAGAGGGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003505.1-2703s21c1
Sequence:CCGGTAATTATTTAGGGCGGTTTAACTCGAGTTAAACCGCCCTAAATAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003505.1-3777s1c1
Sequence:CCGGCCACCAATAATAACCTGGTAACTCGAGTTACCAGGTTATTATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-2129s1c1
Sequence:CCGGGAGCTGCAAGAGCTACGCTATCTCGAGATAGCGTAGCTCTTGCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-2231s1c1
Sequence:CCGGGTACCTTATGACGCTGATCGTCTCGAGACGATCAGCGTCATAAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-1046s1c1
Sequence:CCGGCACGCTCAAGTGTGAGAAGTTCTCGAGAACTTCTCACACTTGAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-1544s1c1
Sequence:CCGGCCGAGTGGTGTGTAATGACAACTCGAGTTGTCATTACACACCACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003505
FZD1 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-1732s21c1
Sequence:CCGGTCGAAGCCAACTCACAGTATTCTCGAGAATACTGTGAGTTGGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-2209s21c1
Sequence:CCGGACTTCACGGTCTTCATGATTACTCGAGTAATCATGAAGACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-868s21c1
Sequence:CCGGAGTTCTACCCTCTAGTGAAAGCTCGAGCTTTCACTAGAGGGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003505.1-2703s21c1
Sequence:CCGGTAATTATTTAGGGCGGTTTAACTCGAGTTAAACCGCCCTAAATAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003505.1-3777s1c1
Sequence:CCGGCCACCAATAATAACCTGGTAACTCGAGTTACCAGGTTATTATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-2129s1c1
Sequence:CCGGGAGCTGCAAGAGCTACGCTATCTCGAGATAGCGTAGCTCTTGCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-2231s1c1
Sequence:CCGGGTACCTTATGACGCTGATCGTCTCGAGACGATCAGCGTCATAAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-1046s1c1
Sequence:CCGGCACGCTCAAGTGTGAGAAGTTCTCGAGAACTTCTCACACTTGAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-1544s1c1
Sequence:CCGGCCGAGTGGTGTGTAATGACAACTCGAGTTGTCATTACACACCACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003505
FZD1 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-1732s21c1
Sequence:CCGGTCGAAGCCAACTCACAGTATTCTCGAGAATACTGTGAGTTGGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-2209s21c1
Sequence:CCGGACTTCACGGTCTTCATGATTACTCGAGTAATCATGAAGACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003505.1-868s21c1
Sequence:CCGGAGTTCTACCCTCTAGTGAAAGCTCGAGCTTTCACTAGAGGGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003505.1-2703s21c1
Sequence:CCGGTAATTATTTAGGGCGGTTTAACTCGAGTTAAACCGCCCTAAATAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003505.1-3777s1c1
Sequence:CCGGCCACCAATAATAACCTGGTAACTCGAGTTACCAGGTTATTATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-2129s1c1
Sequence:CCGGGAGCTGCAAGAGCTACGCTATCTCGAGATAGCGTAGCTCTTGCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-2231s1c1
Sequence:CCGGGTACCTTATGACGCTGATCGTCTCGAGACGATCAGCGTCATAAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-1046s1c1
Sequence:CCGGCACGCTCAAGTGTGAGAAGTTCTCGAGAACTTCTCACACTTGAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003505.1-1544s1c1
Sequence:CCGGCCGAGTGGTGTGTAATGACAACTCGAGTTGTCATTACACACCACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021457
VALIDATED
FZD1 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021457.3-2936s21c1
Sequence:CCGGTTAGGGCAATTTACGTATTTGCTCGAGCAAATACGTAAATTGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-2438s21c1
Sequence:CCGGAGTATCTCATGACGCTGATTGCTCGAGCAATCAGCGTCATGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-1757s21c1
Sequence:CCGGTGGTGTGCAACGACAAGTTTGCTCGAGCAAACTTGTCGTTGCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021457.3-2096s21c1
Sequence:CCGGTGGCGCCTCTCTTCGTTTATCCTCGAGGATAAACGAAGAGAGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-1352s21c1
Sequence:CCGGCAGAGTTCTGGACCAGTAATCCTCGAGGATTACTGGTCCAGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-440s1c1
Sequence:CCGGAGCTTGGAACTTTGTGCCGAACTCGAGTTCGGCACAAAGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-2097s1c1
Sequence:CCGGGCAAGAGTTATGCCATCCCTTCTCGAGAAGGGATGGCATAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-1106s1c1
Sequence:CCGGCCAGAGTTCTGGACCAGTAATCTCGAGATTACTGGTCCAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021457.2-1855s1c1
Sequence:CCGGGCCTCTCTTCGTTTATCTGTTCTCGAGAACAGATAAACGAAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-2267s1c1
Sequence:CCGGAGGAAGTTCTACACGAGGCTTCTCGAGAAGCCTCGTGTAGAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021457
VALIDATED
FZD1 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021457.3-2936s21c1
Sequence:CCGGTTAGGGCAATTTACGTATTTGCTCGAGCAAATACGTAAATTGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-2438s21c1
Sequence:CCGGAGTATCTCATGACGCTGATTGCTCGAGCAATCAGCGTCATGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-1757s21c1
Sequence:CCGGTGGTGTGCAACGACAAGTTTGCTCGAGCAAACTTGTCGTTGCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021457.3-2096s21c1
Sequence:CCGGTGGCGCCTCTCTTCGTTTATCCTCGAGGATAAACGAAGAGAGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-1352s21c1
Sequence:CCGGCAGAGTTCTGGACCAGTAATCCTCGAGGATTACTGGTCCAGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-440s1c1
Sequence:CCGGAGCTTGGAACTTTGTGCCGAACTCGAGTTCGGCACAAAGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-2097s1c1
Sequence:CCGGGCAAGAGTTATGCCATCCCTTCTCGAGAAGGGATGGCATAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-1106s1c1
Sequence:CCGGCCAGAGTTCTGGACCAGTAATCTCGAGATTACTGGTCCAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021457.2-1855s1c1
Sequence:CCGGGCCTCTCTTCGTTTATCTGTTCTCGAGAACAGATAAACGAAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-2267s1c1
Sequence:CCGGAGGAAGTTCTACACGAGGCTTCTCGAGAAGCCTCGTGTAGAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021457
VALIDATED
FZD1 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021457.3-2936s21c1
Sequence:CCGGTTAGGGCAATTTACGTATTTGCTCGAGCAAATACGTAAATTGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-2438s21c1
Sequence:CCGGAGTATCTCATGACGCTGATTGCTCGAGCAATCAGCGTCATGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-1757s21c1
Sequence:CCGGTGGTGTGCAACGACAAGTTTGCTCGAGCAAACTTGTCGTTGCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021457.3-2096s21c1
Sequence:CCGGTGGCGCCTCTCTTCGTTTATCCTCGAGGATAAACGAAGAGAGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021457.3-1352s21c1
Sequence:CCGGCAGAGTTCTGGACCAGTAATCCTCGAGGATTACTGGTCCAGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-440s1c1
Sequence:CCGGAGCTTGGAACTTTGTGCCGAACTCGAGTTCGGCACAAAGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-2097s1c1
Sequence:CCGGGCAAGAGTTATGCCATCCCTTCTCGAGAAGGGATGGCATAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-1106s1c1
Sequence:CCGGCCAGAGTTCTGGACCAGTAATCTCGAGATTACTGGTCCAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021457.2-1855s1c1
Sequence:CCGGGCCTCTCTTCGTTTATCTGTTCTCGAGAACAGATAAACGAAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021457.2-2267s1c1
Sequence:CCGGAGGAAGTTCTACACGAGGCTTCTCGAGAAGCCTCGTGTAGAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks