EMAIL THIS PAGE TO A FRIEND

FZD2

frizzled family receptor 2

59 Gene Product Result for
Synonyms: Fz2 fz-2 fzE2 hFz2
UniProtKB ID: Q14332, Q0VG82
Gene ID:
Human(2535) Summary: This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
Mouse(57265) frizzled homolog 2 (Drosophila)
Rat(64512) frizzled family receptor 2
Zebrafish(30370) frizzled homolog 2
domestic cat(101085253) frizzled family receptor 2
cow(538507) frizzled family receptor 2
dog(490937) frizzled family receptor 2
chicken(374061) frizzled family receptor 2
naked mole-rat(101713401) frizzled family receptor 2
domestic guinea pig(100726820) frizzled family receptor 2
sheep(101116667) frizzled family receptor 2
sheep(780481) frizzled family receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001466 Rosetta Predictions human pricing
NM_172035 Rosetta Predictions rat pricing
NM_020510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144488 predicted 1670
2 SASI_Hs01_00144489 predicted 987
3 SASI_Hs01_00144490 predicted 934
4 SASI_Hs01_00144491 predicted 1053
5 SASI_Hs01_00144492 predicted 1052
6 SASI_Hs01_00144493 predicted 1646
7 SASI_Hs01_00144494 predicted 1325
8 SASI_Hs01_00144495 predicted 381
9 SASI_Hs01_00144496 predicted 919
10 SASI_Hs02_00331907 predicted 753
11 SASI_Hs01_00144487 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105733 predicted 843
2 SASI_Rn01_00105734 predicted 710
3 SASI_Rn02_00269125 predicted 1064
4 SASI_Rn01_00105736 predicted 858
5 SASI_Rn01_00105739 predicted 1064
6 SASI_Rn01_00105740 predicted 782
7 SASI_Rn01_00105741 predicted 725
8 SASI_Rn02_00269126 predicted 730
9 SASI_Rn01_00105742 predicted 1569
10 SASI_Rn02_00269127 predicted 1049
11 SASI_Rn01_00105735 predicted 1020
12 SASI_Rn01_00105737 predicted 1024
13 SASI_Rn01_00105738 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106082 predicted 1236
2 SASI_Mm01_00106083 predicted 1579
3 SASI_Mm01_00106084 predicted 1067
4 SASI_Mm01_00106085 predicted 1065
5 SASI_Mm01_00106086 predicted 941
6 SASI_Mm01_00106087 predicted 957
7 SASI_Mm01_00106088 predicted 1792
8 SASI_Mm01_00106089 predicted 1118
9 SASI_Mm01_00106090 predicted 1240
10 SASI_Mm01_00106091 predicted 1845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001466
VALIDATED
FZD2 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-775s21c1
Sequence:CCGGTTTCTGGGCGAGCGTGATTGTCTCGAGACAATCACGCTCGCCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-921s21c1
Sequence:CCGGCACCACGTACTTGGTAGACATCTCGAGATGTCTACCAAGTACGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-1677s21c1
Sequence:CCGGGCCCGACTTCACGGTCTACATCTCGAGATGTAGACCGTGAAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-753s21c1
Sequence:CCGGGCCATCCTATCTCAGCTACAACTCGAGTTGTAGCTGAGATAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-1701s21c1
Sequence:CCGGCAAATACCTCATGACGCTCATCTCGAGATGAGCGTCATGAGGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-956s21c1
Sequence:CCGGACCCAGAGCGGCCTATCATTTCTCGAGAAATGATAGGCCGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-820s21c1
Sequence:CCGGCCCGATGGTTCCATGTTCTTCCTCGAGGAAGAACATGGAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-753s1c1
Sequence:CCGGGCCATCCTATCTCAGCTACAACTCGAGTTGTAGCTGAGATAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-819s1c1
Sequence:CCGGGCCCGATGGTTCCATGTTCTTCTCGAGAAGAACATGGAACCATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-1677s1c1
Sequence:CCGGGCCCGACTTCACGGTCTACATCTCGAGATGTAGACCGTGAAGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001466.2-921s1c1
Sequence:CCGGCACCACGTACTTGGTAGACATCTCGAGATGTCTACCAAGTACGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001466
VALIDATED
FZD2 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-775s21c1
Sequence:CCGGTTTCTGGGCGAGCGTGATTGTCTCGAGACAATCACGCTCGCCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-921s21c1
Sequence:CCGGCACCACGTACTTGGTAGACATCTCGAGATGTCTACCAAGTACGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-1677s21c1
Sequence:CCGGGCCCGACTTCACGGTCTACATCTCGAGATGTAGACCGTGAAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-753s21c1
Sequence:CCGGGCCATCCTATCTCAGCTACAACTCGAGTTGTAGCTGAGATAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-1701s21c1
Sequence:CCGGCAAATACCTCATGACGCTCATCTCGAGATGAGCGTCATGAGGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-956s21c1
Sequence:CCGGACCCAGAGCGGCCTATCATTTCTCGAGAAATGATAGGCCGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-820s21c1
Sequence:CCGGCCCGATGGTTCCATGTTCTTCCTCGAGGAAGAACATGGAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-753s1c1
Sequence:CCGGGCCATCCTATCTCAGCTACAACTCGAGTTGTAGCTGAGATAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-819s1c1
Sequence:CCGGGCCCGATGGTTCCATGTTCTTCTCGAGAAGAACATGGAACCATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-1677s1c1
Sequence:CCGGGCCCGACTTCACGGTCTACATCTCGAGATGTAGACCGTGAAGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001466.2-921s1c1
Sequence:CCGGCACCACGTACTTGGTAGACATCTCGAGATGTCTACCAAGTACGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001466
VALIDATED
FZD2 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-775s21c1
Sequence:CCGGTTTCTGGGCGAGCGTGATTGTCTCGAGACAATCACGCTCGCCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-921s21c1
Sequence:CCGGCACCACGTACTTGGTAGACATCTCGAGATGTCTACCAAGTACGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-1677s21c1
Sequence:CCGGGCCCGACTTCACGGTCTACATCTCGAGATGTAGACCGTGAAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-753s21c1
Sequence:CCGGGCCATCCTATCTCAGCTACAACTCGAGTTGTAGCTGAGATAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-1701s21c1
Sequence:CCGGCAAATACCTCATGACGCTCATCTCGAGATGAGCGTCATGAGGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-956s21c1
Sequence:CCGGACCCAGAGCGGCCTATCATTTCTCGAGAAATGATAGGCCGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001466.2-820s21c1
Sequence:CCGGCCCGATGGTTCCATGTTCTTCCTCGAGGAAGAACATGGAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-753s1c1
Sequence:CCGGGCCATCCTATCTCAGCTACAACTCGAGTTGTAGCTGAGATAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-819s1c1
Sequence:CCGGGCCCGATGGTTCCATGTTCTTCTCGAGAAGAACATGGAACCATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001466.2-1677s1c1
Sequence:CCGGGCCCGACTTCACGGTCTACATCTCGAGATGTAGACCGTGAAGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001466.2-921s1c1
Sequence:CCGGCACCACGTACTTGGTAGACATCTCGAGATGTCTACCAAGTACGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020510
VALIDATED
FZD2 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020510.2-2428s21c1
Sequence:CCGGCACCTAGCCTGCTCGCTATTTCTCGAGAAATAGCGAGCAGGCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-938s21c1
Sequence:CCGGCCGTCCTATCTCAGCTATAAGCTCGAGCTTATAGCTGAGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1242s21c1
Sequence:CCGGGCTTCTCAGAGGACGGTTATCCTCGAGGATAACCGTCCTCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1869s21c1
Sequence:CCGGTCACAGTCTACATGATCAAATCTCGAGATTTGATCATGTAGACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1096s21c1
Sequence:CCGGCTTCACGGTCACCACCTATTTCTCGAGAAATAGGTGGTGACCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020510.1-891s1c1
Sequence:CCGGGCCGTCCTATCTCAGCTATAACTCGAGTTATAGCTGAGATAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1824s1c1
Sequence:CCGGCACAGTCTACATGATCAAATACTCGAGTATTTGATCATGTAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020510.1-1195s1c1
Sequence:CCGGCGCTTCTCAGAGGACGGTTATCTCGAGATAACCGTCCTCTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1059s1c1
Sequence:CCGGCACCACCTATTTAGTGGACATCTCGAGATGTCCACTAAATAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1527s1c1
Sequence:CCGGGCTCTTCGTATACCTGTTCATCTCGAGATGAACAGGTATACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020510
VALIDATED
FZD2 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020510.2-2428s21c1
Sequence:CCGGCACCTAGCCTGCTCGCTATTTCTCGAGAAATAGCGAGCAGGCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-938s21c1
Sequence:CCGGCCGTCCTATCTCAGCTATAAGCTCGAGCTTATAGCTGAGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1242s21c1
Sequence:CCGGGCTTCTCAGAGGACGGTTATCCTCGAGGATAACCGTCCTCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1869s21c1
Sequence:CCGGTCACAGTCTACATGATCAAATCTCGAGATTTGATCATGTAGACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1096s21c1
Sequence:CCGGCTTCACGGTCACCACCTATTTCTCGAGAAATAGGTGGTGACCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020510.1-891s1c1
Sequence:CCGGGCCGTCCTATCTCAGCTATAACTCGAGTTATAGCTGAGATAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1824s1c1
Sequence:CCGGCACAGTCTACATGATCAAATACTCGAGTATTTGATCATGTAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020510.1-1195s1c1
Sequence:CCGGCGCTTCTCAGAGGACGGTTATCTCGAGATAACCGTCCTCTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1059s1c1
Sequence:CCGGCACCACCTATTTAGTGGACATCTCGAGATGTCCACTAAATAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1527s1c1
Sequence:CCGGGCTCTTCGTATACCTGTTCATCTCGAGATGAACAGGTATACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020510
VALIDATED
FZD2 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020510.2-2428s21c1
Sequence:CCGGCACCTAGCCTGCTCGCTATTTCTCGAGAAATAGCGAGCAGGCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-938s21c1
Sequence:CCGGCCGTCCTATCTCAGCTATAAGCTCGAGCTTATAGCTGAGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1242s21c1
Sequence:CCGGGCTTCTCAGAGGACGGTTATCCTCGAGGATAACCGTCCTCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1869s21c1
Sequence:CCGGTCACAGTCTACATGATCAAATCTCGAGATTTGATCATGTAGACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020510.2-1096s21c1
Sequence:CCGGCTTCACGGTCACCACCTATTTCTCGAGAAATAGGTGGTGACCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020510.1-891s1c1
Sequence:CCGGGCCGTCCTATCTCAGCTATAACTCGAGTTATAGCTGAGATAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1824s1c1
Sequence:CCGGCACAGTCTACATGATCAAATACTCGAGTATTTGATCATGTAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020510.1-1195s1c1
Sequence:CCGGCGCTTCTCAGAGGACGGTTATCTCGAGATAACCGTCCTCTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1059s1c1
Sequence:CCGGCACCACCTATTTAGTGGACATCTCGAGATGTCCACTAAATAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020510.1-1527s1c1
Sequence:CCGGGCTCTTCGTATACCTGTTCATCTCGAGATGAACAGGTATACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks