EMAIL THIS PAGE TO A FRIEND

FZD3

frizzled family receptor 3

57 Gene Product Result for
Synonyms: Fz-3
UniProtKB ID: Q9NPG1
Gene ID:
Human(7976) Summary: This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. The function of this protein is unknown, although it may play a role in mammalian hair follicle development. Alternative splicing results in multiple transcript variants. This gene is a susceptibility locus for schizophrenia. [provided by RefSeq, Dec 2010]
Mouse(14365) frizzled homolog 3 (Drosophila)
Rat(266715) frizzled family receptor 3
sheep(780482) frizzled family receptor 3
domestic guinea pig(100716417) frizzled family receptor 3
naked mole-rat(101697238) frizzled family receptor 3
chicken(395572) frizzled family receptor 3
cow(445419) frizzled family receptor 3
Horse(100054732) frizzled family receptor 3
dog(486093) frizzled family receptor 3
domestic cat(101095250) frizzled family receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017412 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017412 Rosetta Predictions human pricing
NM_153474 Rosetta Predictions rat pricing
NM_021458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134080 predicted 860
2 SASI_Hs01_00134081 predicted 1299
3 SASI_Hs01_00134082 predicted 1659
4 SASI_Hs01_00134083 predicted 2028
5 SASI_Hs01_00134084 predicted 1671
6 SASI_Hs01_00134085 predicted 526
7 SASI_Hs01_00134086 predicted 607
8 SASI_Hs01_00134088 predicted 2546
9 SASI_Hs01_00134089 predicted 740
10 SASI_Hs02_00349974 predicted 1078
11 SASI_Hs01_00134087 predicted 2555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085085 predicted 506
2 SASI_Rn01_00085086 predicted 1423
3 SASI_Rn01_00085088 predicted 1557
4 SASI_Rn01_00085089 predicted 636
5 SASI_Rn01_00085090 predicted 1535
6 SASI_Rn01_00085091 predicted 574
7 SASI_Rn01_00085092 predicted 762
8 SASI_Rn02_00268989 predicted 1198
9 SASI_Rn01_00085094 predicted 1923
10 SASI_Rn02_00268990 predicted 1263
11 SASI_Rn01_00085087 predicted 2337
12 SASI_Rn01_00085093 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074582 predicted 1365
2 SASI_Mm01_00074583 predicted 871
3 SASI_Mm02_00326108 predicted 572
4 SASI_Mm01_00074584 predicted 1495
5 SASI_Mm01_00074585 predicted 2146
6 SASI_Mm01_00074586 predicted 443
7 SASI_Mm01_00074587 predicted 517
8 SASI_Mm01_00074588 predicted 697
9 SASI_Mm01_00074591 predicted 1105
10 SASI_Mm02_00326109 predicted 1205
11 SASI_Mm01_00074589 predicted 739
12 SASI_Mm01_00074590 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017412
VALIDATED
FZD3 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-616s1c1
Sequence:CCGGGCCTAATCTTCTGAATCATTACTCGAGTAATGATTCAGAAGATTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-890s1c1
Sequence:CCGGCCTCGACTTGTGGATCTGAATCTCGAGATTCAGATCCACAAGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-733s1c1
Sequence:CCGGCGCTCCTATTTGTATGGAATACTCGAGTATTCCATACAAATAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-1851s1c1
Sequence:CCGGGCAGAGAATATCACATTCCATCTCGAGATGGAATGTGATATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-3576s1c1
Sequence:CCGGCCTCAGTCCAAAGTGGTGATTCTCGAGAATCACCACTTTGGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017412.2-723s21c1
Sequence:CCGGGTGCACTCTACGCTCCTATTTCTCGAGAAATAGGAGCGTAGAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017412.2-1176s21c1
Sequence:CCGGATCCTGAAAGGCCTATTATATCTCGAGATATAATAGGCCTTTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017412.2-1072s21c1
Sequence:CCGGACTGTCATTTGCTCGCTATTTCTCGAGAAATAGCGAGCAAATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017412
VALIDATED
FZD3 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-616s1c1
Sequence:CCGGGCCTAATCTTCTGAATCATTACTCGAGTAATGATTCAGAAGATTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-890s1c1
Sequence:CCGGCCTCGACTTGTGGATCTGAATCTCGAGATTCAGATCCACAAGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-733s1c1
Sequence:CCGGCGCTCCTATTTGTATGGAATACTCGAGTATTCCATACAAATAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-1851s1c1
Sequence:CCGGGCAGAGAATATCACATTCCATCTCGAGATGGAATGTGATATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-3576s1c1
Sequence:CCGGCCTCAGTCCAAAGTGGTGATTCTCGAGAATCACCACTTTGGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017412.2-723s21c1
Sequence:CCGGGTGCACTCTACGCTCCTATTTCTCGAGAAATAGGAGCGTAGAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017412.2-1176s21c1
Sequence:CCGGATCCTGAAAGGCCTATTATATCTCGAGATATAATAGGCCTTTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017412.2-1072s21c1
Sequence:CCGGACTGTCATTTGCTCGCTATTTCTCGAGAAATAGCGAGCAAATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017412
VALIDATED
FZD3 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-616s1c1
Sequence:CCGGGCCTAATCTTCTGAATCATTACTCGAGTAATGATTCAGAAGATTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-890s1c1
Sequence:CCGGCCTCGACTTGTGGATCTGAATCTCGAGATTCAGATCCACAAGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-733s1c1
Sequence:CCGGCGCTCCTATTTGTATGGAATACTCGAGTATTCCATACAAATAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-1851s1c1
Sequence:CCGGGCAGAGAATATCACATTCCATCTCGAGATGGAATGTGATATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017412.2-3576s1c1
Sequence:CCGGCCTCAGTCCAAAGTGGTGATTCTCGAGAATCACCACTTTGGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017412.2-723s21c1
Sequence:CCGGGTGCACTCTACGCTCCTATTTCTCGAGAAATAGGAGCGTAGAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017412.2-1176s21c1
Sequence:CCGGATCCTGAAAGGCCTATTATATCTCGAGATATAATAGGCCTTTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017412.2-1072s21c1
Sequence:CCGGACTGTCATTTGCTCGCTATTTCTCGAGAAATAGCGAGCAAATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021458
FZD3 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000071553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-522s1c1
Sequence:CCGGCCTGGATTGTTCTCGGGATTTCTCGAGAAATCCCGAGAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-1513s1c1
Sequence:CCGGCGGATTGAGATCCCATTAGAACTCGAGTTCTAATGGGATCTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-419s1c1
Sequence:CCGGGCCAAGATTTGCCTTACAATACTCGAGTATTGTAAGGCAAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-2245s1c1
Sequence:CCGGCCCATGACTCACATTACACATCTCGAGATGTGTAATGTGAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021458
FZD3 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000071553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-522s1c1
Sequence:CCGGCCTGGATTGTTCTCGGGATTTCTCGAGAAATCCCGAGAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-1513s1c1
Sequence:CCGGCGGATTGAGATCCCATTAGAACTCGAGTTCTAATGGGATCTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-419s1c1
Sequence:CCGGGCCAAGATTTGCCTTACAATACTCGAGTATTGTAAGGCAAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-2245s1c1
Sequence:CCGGCCCATGACTCACATTACACATCTCGAGATGTGTAATGTGAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021458
FZD3 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000071553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-522s1c1
Sequence:CCGGCCTGGATTGTTCTCGGGATTTCTCGAGAAATCCCGAGAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-1513s1c1
Sequence:CCGGCGGATTGAGATCCCATTAGAACTCGAGTTCTAATGGGATCTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-419s1c1
Sequence:CCGGGCCAAGATTTGCCTTACAATACTCGAGTATTGTAAGGCAAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021458.1-2245s1c1
Sequence:CCGGCCCATGACTCACATTACACATCTCGAGATGTGTAATGTGAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks