EMAIL THIS PAGE TO A FRIEND

FZD4

frizzled family receptor 4

Synonyms: CD344 EVR1 FEVR FZD4S Fz-4 Fz4 FzE4 GPCR hFz4
UniProtKB ID: Q9ULV1, A8K9Q3, Q14C97, Q6S9E4
Gene ID:
Human(8322) Summary: This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This protein may play a role as a positive regulator of the Wingless type MMTV integration site signaling pathway. A transcript variant retaining intronic sequence and encoding a shorter isoform has been described, however, its expression is not supported by other experimental evidence. [provided by RefSeq, Jul 2008]
Mouse(14366) frizzled homolog 4 (Drosophila)
Rat(64558) frizzled family receptor 4
Zebrafish(30363) frizzled homolog 4
cow(445416) frizzled family receptor 4
Horse(100050465) frizzled family receptor 4
domestic cat(101093710) frizzled family receptor 4
dog(485149) frizzled family receptor 4
chicken(373887) frizzled family receptor 4
naked mole-rat(101700404) frizzled family receptor 4
domestic guinea pig(100714941) frizzled family receptor 4
sheep(101101932) frizzled family receptor 4
247 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012193 siRNAs that have been validated in the lab human pricing
NM_022623 Rosetta Predictions rat pricing
NM_008055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012193 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241018 validated 1634
2 SASI_Hs01_00241016 predicted 1494
3 SASI_Hs02_00343828 predicted 2000
4 SASI_Hs01_00241017 predicted 1521
5 SASI_Hs02_00343829 predicted 705
6 SASI_Hs01_00241019 predicted 1078
7 SASI_Hs01_00241020 predicted 1569
8 SASI_Hs01_00241023 predicted 1247
9 SASI_Hs01_00241024 predicted 915
10 SASI_Hs01_00241025 predicted 790
11 SASI_Hs01_00241021 predicted 734
12 SASI_Hs01_00241022 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043789 predicted 852
2 SASI_Rn01_00043790 predicted 863
3 SASI_Rn01_00043791 predicted 984
4 SASI_Rn01_00043792 predicted 1399
5 SASI_Rn01_00043793 predicted 756
6 SASI_Rn01_00043794 predicted 1006
7 SASI_Rn01_00043795 predicted 843
8 SASI_Rn01_00043796 predicted 1158
9 SASI_Rn01_00043797 predicted 1298
10 SASI_Rn02_00263407 predicted 1220
11 SASI_Rn01_00043798 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174870 predicted 1730
2 SASI_Mm01_00174871 predicted 1095
3 SASI_Mm01_00174872 predicted 800
4 SASI_Mm01_00174873 predicted 1408
5 SASI_Mm01_00174874 predicted 1586
6 SASI_Mm01_00174875 predicted 959
7 SASI_Mm01_00174876 predicted 1264
8 SASI_Mm01_00174877 predicted 867
9 SASI_Mm01_00174878 predicted 1851
10 SASI_Mm01_00174879 predicted 1512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012193
FZD4 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012193.2-1077s21c1
Sequence:CCGGTCTCAGTATGTGCTATAATATCTCGAGATATTATAGCACATACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012193.2-1972s21c1
Sequence:CCGGTTTGGAGGAAATTCTACTAAACTCGAGTTTAGTAGAATTTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012193.2-2348s21c1
Sequence:CCGGCAGATAGCAAAGCAATCTATACTCGAGTATAGATTGCTTTGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012193.2-7217s1c1
Sequence:CCGGCCCTGAATGAATTGCTAAATTCTCGAGAATTTAGCAATTCATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-1818s1c1
Sequence:CCGGGCAGAAGTGTTCCAACAGATTCTCGAGAATCTGTTGGAACACTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-615s1c1
Sequence:CCGGGCCAATGTGCACAGAGAAGATCTCGAGATCTTCTCTGTGCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-1652s1c1
Sequence:CCGGCGTGTGTGATTGCCTGTTATTCTCGAGAATAACAGGCAATCACACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-917s1c1
Sequence:CCGGGTGGCTATGATGCTGGCTTATCTCGAGATAAGCCAGCATCATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012193
FZD4 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012193.2-1077s21c1
Sequence:CCGGTCTCAGTATGTGCTATAATATCTCGAGATATTATAGCACATACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012193.2-1972s21c1
Sequence:CCGGTTTGGAGGAAATTCTACTAAACTCGAGTTTAGTAGAATTTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012193.2-2348s21c1
Sequence:CCGGCAGATAGCAAAGCAATCTATACTCGAGTATAGATTGCTTTGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012193.2-7217s1c1
Sequence:CCGGCCCTGAATGAATTGCTAAATTCTCGAGAATTTAGCAATTCATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-1818s1c1
Sequence:CCGGGCAGAAGTGTTCCAACAGATTCTCGAGAATCTGTTGGAACACTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-615s1c1
Sequence:CCGGGCCAATGTGCACAGAGAAGATCTCGAGATCTTCTCTGTGCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-1652s1c1
Sequence:CCGGCGTGTGTGATTGCCTGTTATTCTCGAGAATAACAGGCAATCACACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-917s1c1
Sequence:CCGGGTGGCTATGATGCTGGCTTATCTCGAGATAAGCCAGCATCATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012193
FZD4 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012193.2-1077s21c1
Sequence:CCGGTCTCAGTATGTGCTATAATATCTCGAGATATTATAGCACATACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012193.2-1972s21c1
Sequence:CCGGTTTGGAGGAAATTCTACTAAACTCGAGTTTAGTAGAATTTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012193.2-2348s21c1
Sequence:CCGGCAGATAGCAAAGCAATCTATACTCGAGTATAGATTGCTTTGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012193.2-7217s1c1
Sequence:CCGGCCCTGAATGAATTGCTAAATTCTCGAGAATTTAGCAATTCATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-1818s1c1
Sequence:CCGGGCAGAAGTGTTCCAACAGATTCTCGAGAATCTGTTGGAACACTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-615s1c1
Sequence:CCGGGCCAATGTGCACAGAGAAGATCTCGAGATCTTCTCTGTGCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-1652s1c1
Sequence:CCGGCGTGTGTGATTGCCTGTTATTCTCGAGAATAACAGGCAATCACACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012193.2-917s1c1
Sequence:CCGGGTGGCTATGATGCTGGCTTATCTCGAGATAAGCCAGCATCATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008055
VALIDATED
FZD4 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008055.4-1091s21c1
Sequence:CCGGTTCTCAGTATGTGCTATAATACTCGAGTATTATAGCACATACTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008055.4-1497s21c1
Sequence:CCGGGGCTCCTCTCTTTACGTATTTCTCGAGAAATACGTAAAGAGAGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008055.4-1448s21c1
Sequence:CCGGTGTGCTATGTTGGGAACCAAACTCGAGTTTGGTTCCCAACATAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008055.4-1703s21c1
Sequence:CCGGACTGGGCACTCTTTCGATATTCTCGAGAATATCGAAAGAGTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008055.4-2331s21c1
Sequence:CCGGCAGATAGCAAAGTGATCTATACTCGAGTATAGATCACTTTGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-937s1c1
Sequence:CCGGGCTAAGGAGTTCACGGATATTCTCGAGAATATCCGTGAACTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-685s1c1
Sequence:CCGGGTCCTGAGAGAATTTGGGTTTCTCGAGAAACCCAAATTCTCTCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1421s1c1
Sequence:CCGGTGTGCTATGTTGGGAACCAAACTCGAGTTTGGTTCCCAACATAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1017s1c1
Sequence:CCGGCCTGATTGATTCATCCAGGTTCTCGAGAACCTGGATGAATCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1375s1c1
Sequence:CCGGGTCATCTTGATTATGAGACTACTCGAGTAGTCTCATAATCAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008055
VALIDATED
FZD4 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008055.4-1091s21c1
Sequence:CCGGTTCTCAGTATGTGCTATAATACTCGAGTATTATAGCACATACTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008055.4-1497s21c1
Sequence:CCGGGGCTCCTCTCTTTACGTATTTCTCGAGAAATACGTAAAGAGAGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008055.4-1448s21c1
Sequence:CCGGTGTGCTATGTTGGGAACCAAACTCGAGTTTGGTTCCCAACATAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008055.4-1703s21c1
Sequence:CCGGACTGGGCACTCTTTCGATATTCTCGAGAATATCGAAAGAGTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008055.4-2331s21c1
Sequence:CCGGCAGATAGCAAAGTGATCTATACTCGAGTATAGATCACTTTGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-937s1c1
Sequence:CCGGGCTAAGGAGTTCACGGATATTCTCGAGAATATCCGTGAACTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-685s1c1
Sequence:CCGGGTCCTGAGAGAATTTGGGTTTCTCGAGAAACCCAAATTCTCTCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1421s1c1
Sequence:CCGGTGTGCTATGTTGGGAACCAAACTCGAGTTTGGTTCCCAACATAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1017s1c1
Sequence:CCGGCCTGATTGATTCATCCAGGTTCTCGAGAACCTGGATGAATCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1375s1c1
Sequence:CCGGGTCATCTTGATTATGAGACTACTCGAGTAGTCTCATAATCAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008055
VALIDATED
FZD4 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008055.4-1091s21c1
Sequence:CCGGTTCTCAGTATGTGCTATAATACTCGAGTATTATAGCACATACTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008055.4-1497s21c1
Sequence:CCGGGGCTCCTCTCTTTACGTATTTCTCGAGAAATACGTAAAGAGAGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008055.4-1448s21c1
Sequence:CCGGTGTGCTATGTTGGGAACCAAACTCGAGTTTGGTTCCCAACATAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008055.4-1703s21c1
Sequence:CCGGACTGGGCACTCTTTCGATATTCTCGAGAATATCGAAAGAGTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008055.4-2331s21c1
Sequence:CCGGCAGATAGCAAAGTGATCTATACTCGAGTATAGATCACTTTGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-937s1c1
Sequence:CCGGGCTAAGGAGTTCACGGATATTCTCGAGAATATCCGTGAACTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-685s1c1
Sequence:CCGGGTCCTGAGAGAATTTGGGTTTCTCGAGAAACCCAAATTCTCTCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1421s1c1
Sequence:CCGGTGTGCTATGTTGGGAACCAAACTCGAGTTTGGTTCCCAACATAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1017s1c1
Sequence:CCGGCCTGATTGATTCATCCAGGTTCTCGAGAACCTGGATGAATCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008055.2-1375s1c1
Sequence:CCGGGTCATCTTGATTATGAGACTACTCGAGTAGTCTCATAATCAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks