EMAIL THIS PAGE TO A FRIEND

FZD5

frizzled family receptor 5

Synonyms: C2orf31 HFZ5
UniProtKB ID: Q13467, Q53R22
Gene ID:
Human(7855) Summary: Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD5 protein is believed to be the receptor for the Wnt5A ligand. [provided by RefSeq, Jul 2008]
Mouse(14367) frizzled homolog 5 (Drosophila)
Rat(317674) frizzled family receptor 5
sheep(101118762) frizzled family receptor 5
domestic guinea pig(100728348) frizzled family receptor 5
naked mole-rat(101708659) frizzled family receptor 5
Zebrafish(30364) frizzled homolog 5
domestic cat(101097508) frizzled family receptor 5
cow(538536) frizzled family receptor 5
dog(488493) frizzled family receptor 5
chicken(395571) frizzled family receptor 5
196 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003468 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003468 siRNAs that have been validated in the lab human pricing
NM_173838 Rosetta Predictions rat pricing
NM_001042659 Rosetta Predictions mouse pricing
NM_022721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003468 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024767 validated 1743
1 SASI_Hs01_00024769 validated 554
2 SASI_Hs01_00024768 predicted 675
3 SASI_Hs01_00024770 predicted 987
4 SASI_Hs01_00024771 predicted 1225
5 SASI_Hs01_00024772 predicted 1183
6 SASI_Hs01_00024773 predicted 1009
7 SASI_Hs01_00024774 predicted 1799
8 SASI_Hs01_00024775 predicted 1790
9 SASI_Hs01_00024776 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269472 predicted 896
2 SASI_Rn01_00076066 predicted 599
3 SASI_Rn01_00076067 predicted 940
4 SASI_Rn01_00076068 predicted 1053
5 SASI_Rn01_00076069 predicted 936
6 SASI_Rn01_00076071 predicted 758
7 SASI_Rn02_00269473 predicted 269
8 SASI_Rn01_00076072 predicted 818
9 SASI_Rn01_00076073 predicted 1215
10 SASI_Rn01_00076074 predicted 1341
11 SASI_Rn01_00076065 predicted 1333
12 SASI_Rn01_00076070 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290875 predicted 901
2 SASI_Mm02_00290876 predicted 1033
3 SASI_Mm02_00290877 predicted 2541
4 SASI_Mm02_00290878 predicted 1819
5 SASI_Mm02_00290879 predicted 1367
6 SASI_Mm02_00290880 predicted 2604
7 SASI_Mm02_00290881 predicted 2159
8 SASI_Mm02_00290882 predicted 2569
9 SASI_Mm02_00290883 predicted 890
10 SASI_Mm02_00290884 predicted 2661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164332 predicted 1010
2 SASI_Mm01_00164333 predicted 1142
3 SASI_Mm01_00164334 predicted 2645
4 SASI_Mm01_00164335 predicted 1925
5 SASI_Mm01_00164336 predicted 1466
6 SASI_Mm01_00164337 predicted 2715
7 SASI_Mm01_00164338 predicted 2262
8 SASI_Mm01_00164339 predicted 2671
9 SASI_Mm01_00164340 predicted 1003
10 SASI_Mm02_00326641 predicted 2766
11 SASI_Mm01_00164331 predicted 2208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022721
VALIDATED
FZD5 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-2854s1c1
Sequence:CCGGGCATTTCTTACTGCTTTCTTTCTCGAGAAAGAAAGCAGTAAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022721.2-1779s1c1
Sequence:CCGGGCCACATTCACTATGAGACTACTCGAGTAGTCTCATAGTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022721.2-1642s1c1
Sequence:CCGGCCTCATTGACATGGAACGATTCTCGAGAATCGTTCCATGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-2272s1c1
Sequence:CCGGCTACCTGTATGAGCAGCACTACTCGAGTAGTGCTGCTCATACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-1300s1c1
Sequence:CCGGCGAGGTTCTGTGTATGGATTACTCGAGTAATCCATACACAGAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022721
VALIDATED
FZD5 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-2854s1c1
Sequence:CCGGGCATTTCTTACTGCTTTCTTTCTCGAGAAAGAAAGCAGTAAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022721.2-1779s1c1
Sequence:CCGGGCCACATTCACTATGAGACTACTCGAGTAGTCTCATAGTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022721.2-1642s1c1
Sequence:CCGGCCTCATTGACATGGAACGATTCTCGAGAATCGTTCCATGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-2272s1c1
Sequence:CCGGCTACCTGTATGAGCAGCACTACTCGAGTAGTGCTGCTCATACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-1300s1c1
Sequence:CCGGCGAGGTTCTGTGTATGGATTACTCGAGTAATCCATACACAGAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022721
VALIDATED
FZD5 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-2854s1c1
Sequence:CCGGGCATTTCTTACTGCTTTCTTTCTCGAGAAAGAAAGCAGTAAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022721.2-1779s1c1
Sequence:CCGGGCCACATTCACTATGAGACTACTCGAGTAGTCTCATAGTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022721.2-1642s1c1
Sequence:CCGGCCTCATTGACATGGAACGATTCTCGAGAATCGTTCCATGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-2272s1c1
Sequence:CCGGCTACCTGTATGAGCAGCACTACTCGAGTAGTGCTGCTCATACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022721.2-1300s1c1
Sequence:CCGGCGAGGTTCTGTGTATGGATTACTCGAGTAATCCATACACAGAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003468
FZD5 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003468.2-2348s1c1
Sequence:CCGGGCGTTTCTTACTGCCTTCTTTCTCGAGAAAGAAGGCAGTAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-1876s1c1
Sequence:CCGGGCCCGAGTACTGGGTGCTCATCTCGAGATGAGCACCCAGTACTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-814s1c1
Sequence:CCGGCGAGGTCCTCTGCATGGATTACTCGAGTAATCCATGCAGAGGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-484s1c1
Sequence:CCGGCCAGGAAATCACGGTGCCCATCTCGAGATGGGCACCGTGATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-962s1c1
Sequence:CCGGCGCGAGCCCTTCGTGCCCATTCTCGAGAATGGGCACGAAGGGCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003468.3-2535s21c1
Sequence:CCGGTTGAACTGTGTGGTCTCAATTCTCGAGAATTGAGACCACACAGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003468.3-1189s21c1
Sequence:CCGGACATGGAACGCTTCCGCTATCCTCGAGGATAGCGGAAGCGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003468.3-1748s21c1
Sequence:CCGGCATGATCCGCATCGGCATCTTCTCGAGAAGATGCCGATGCGGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003468.3-2489s21c1
Sequence:CCGGTCCTAAGGTTGGCGTTGTAATCTCGAGATTACAACGCCAACCTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003468
FZD5 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003468.2-2348s1c1
Sequence:CCGGGCGTTTCTTACTGCCTTCTTTCTCGAGAAAGAAGGCAGTAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-1876s1c1
Sequence:CCGGGCCCGAGTACTGGGTGCTCATCTCGAGATGAGCACCCAGTACTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-814s1c1
Sequence:CCGGCGAGGTCCTCTGCATGGATTACTCGAGTAATCCATGCAGAGGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-484s1c1
Sequence:CCGGCCAGGAAATCACGGTGCCCATCTCGAGATGGGCACCGTGATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-962s1c1
Sequence:CCGGCGCGAGCCCTTCGTGCCCATTCTCGAGAATGGGCACGAAGGGCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003468.3-2535s21c1
Sequence:CCGGTTGAACTGTGTGGTCTCAATTCTCGAGAATTGAGACCACACAGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003468.3-1189s21c1
Sequence:CCGGACATGGAACGCTTCCGCTATCCTCGAGGATAGCGGAAGCGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003468.3-1748s21c1
Sequence:CCGGCATGATCCGCATCGGCATCTTCTCGAGAAGATGCCGATGCGGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003468.3-2489s21c1
Sequence:CCGGTCCTAAGGTTGGCGTTGTAATCTCGAGATTACAACGCCAACCTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003468
FZD5 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003468.2-2348s1c1
Sequence:CCGGGCGTTTCTTACTGCCTTCTTTCTCGAGAAAGAAGGCAGTAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-1876s1c1
Sequence:CCGGGCCCGAGTACTGGGTGCTCATCTCGAGATGAGCACCCAGTACTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-814s1c1
Sequence:CCGGCGAGGTCCTCTGCATGGATTACTCGAGTAATCCATGCAGAGGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-484s1c1
Sequence:CCGGCCAGGAAATCACGGTGCCCATCTCGAGATGGGCACCGTGATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003468.2-962s1c1
Sequence:CCGGCGCGAGCCCTTCGTGCCCATTCTCGAGAATGGGCACGAAGGGCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003468.3-2535s21c1
Sequence:CCGGTTGAACTGTGTGGTCTCAATTCTCGAGAATTGAGACCACACAGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003468.3-1189s21c1
Sequence:CCGGACATGGAACGCTTCCGCTATCCTCGAGGATAGCGGAAGCGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003468.3-1748s21c1
Sequence:CCGGCATGATCCGCATCGGCATCTTCTCGAGAAGATGCCGATGCGGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003468.3-2489s21c1
Sequence:CCGGTCCTAAGGTTGGCGTTGTAATCTCGAGATTACAACGCCAACCTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks