EMAIL THIS PAGE TO A FRIEND

FZD6

frizzled family receptor 6

79 Gene Product Result for
Synonyms: FZ-6 FZ6 HFZ6 NDNC10
UniProtKB ID: O60353, B4DRN0, Q6N0A5, Q6P9C3, Q8WXR9
Gene ID:
Human(8323) Summary: This gene represents a member of the 'frizzled' gene family, which encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The protein encoded by this family member contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, and seven transmembrane domains, but unlike other family members, this protein does not contain a C-terminal PDZ domain-binding motif. This protein functions as a negative regulator of the canonical Wnt/beta-catenin signaling cascade, thereby inhibiting the processes that trigger oncogenic transformation, cell proliferation, and inhibition of apoptosis. Alternative splicing results in multiple transcript variants, some of which do not encode a protein with a predicted signal peptide.[provided by RefSeq, Aug 2011]
Mouse(14368) frizzled homolog 6 (Drosophila)
Rat(282581) frizzled family receptor 6
Zebrafish(393533) frizzled homolog 6 (Drosophila)
cow(445418) frizzled family receptor 6
dog(403610) frizzled family receptor 6
domestic cat(101101443) frizzled family receptor 6
chicken(378788) frizzled family receptor 6
naked mole-rat(101722552) frizzled family receptor 6
domestic guinea pig(100719748) frizzled family receptor 6
sheep(101122197) frizzled family receptor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003506 siRNAs that have been validated in the lab human pricing
NM_001130536 Rosetta Predictions rat pricing
NM_008056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003506 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068346 validated 1999
1 SASI_Hs01_00068345 validated 993
1 SASI_Hs01_00068347 validated 2226
2 SASI_Hs02_00335793 predicted 2466
3 SASI_Hs01_00068348 predicted 2015
4 SASI_Hs01_00068349 predicted 691
5 SASI_Hs01_00068350 predicted 1446
6 SASI_Hs01_00068351 predicted 554
7 SASI_Hs01_00068354 predicted 637
8 SASI_Hs02_00335794 predicted 1988
9 SASI_Hs01_00068352 predicted 349
10 SASI_Hs01_00068353 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255549 predicted 1030
2 SASI_Rn02_00255550 predicted 1447
3 SASI_Rn02_00255551 predicted 570
4 SASI_Rn02_00255552 predicted 499
5 SASI_Rn02_00255553 predicted 1057
6 SASI_Rn02_00255554 predicted 746
7 SASI_Rn02_00255555 predicted 369
8 SASI_Rn02_00255556 predicted 1468
9 SASI_Rn02_00255557 predicted 426
10 SASI_Rn02_00255558 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123322 predicted 986
2 SASI_Mm01_00123323 predicted 2112
3 SASI_Mm01_00123324 predicted 1339
4 SASI_Mm01_00123325 predicted 1071
5 SASI_Mm01_00123326 predicted 572
6 SASI_Mm01_00123327 predicted 518
7 SASI_Mm01_00123328 predicted 1802
8 SASI_Mm01_00123329 predicted 434
9 SASI_Mm01_00123330 predicted 1652
10 SASI_Mm01_00123331 predicted 1687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003506
FZD6 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003506.3-2272s21c1
Sequence:CCGGTTAGTCCAAAGAGTGATATTACTCGAGTAATATCACTCTTTGGACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003506.3-2636s21c1
Sequence:CCGGACAGAAATGTGCAGGTTAATACTCGAGTATTAACCTGCACATTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003506.3-1003s21c1
Sequence:CCGGACCCAGAGAGACCAATTATATCTCGAGATATAATTGGTCTCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003506.2-3240s1c1
Sequence:CCGGCCACCCATTGATTGTATTATACTCGAGTATAATACAATCAATGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-1539s1c1
Sequence:CCGGCGGCTTGTATCTTGTGCCATTCTCGAGAATGGCACAAGATACAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-2262s1c1
Sequence:CCGGCCTGGCACAGAGCAACAATTTCTCGAGAAATTGTTGCTCTGTGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-1653s1c1
Sequence:CCGGCCCATGTCCTTATCAGGCAAACTCGAGTTTGCCTGATAAGGACATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-402s1c1
Sequence:CCGGCCCTAATCTGATGGGTCATTACTCGAGTAATGACCCATCAGATTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003506
FZD6 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003506.3-2272s21c1
Sequence:CCGGTTAGTCCAAAGAGTGATATTACTCGAGTAATATCACTCTTTGGACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003506.3-2636s21c1
Sequence:CCGGACAGAAATGTGCAGGTTAATACTCGAGTATTAACCTGCACATTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003506.3-1003s21c1
Sequence:CCGGACCCAGAGAGACCAATTATATCTCGAGATATAATTGGTCTCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003506.2-3240s1c1
Sequence:CCGGCCACCCATTGATTGTATTATACTCGAGTATAATACAATCAATGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-1539s1c1
Sequence:CCGGCGGCTTGTATCTTGTGCCATTCTCGAGAATGGCACAAGATACAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-2262s1c1
Sequence:CCGGCCTGGCACAGAGCAACAATTTCTCGAGAAATTGTTGCTCTGTGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-1653s1c1
Sequence:CCGGCCCATGTCCTTATCAGGCAAACTCGAGTTTGCCTGATAAGGACATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-402s1c1
Sequence:CCGGCCCTAATCTGATGGGTCATTACTCGAGTAATGACCCATCAGATTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003506
FZD6 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003506.3-2272s21c1
Sequence:CCGGTTAGTCCAAAGAGTGATATTACTCGAGTAATATCACTCTTTGGACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003506.3-2636s21c1
Sequence:CCGGACAGAAATGTGCAGGTTAATACTCGAGTATTAACCTGCACATTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003506.3-1003s21c1
Sequence:CCGGACCCAGAGAGACCAATTATATCTCGAGATATAATTGGTCTCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003506.2-3240s1c1
Sequence:CCGGCCACCCATTGATTGTATTATACTCGAGTATAATACAATCAATGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-1539s1c1
Sequence:CCGGCGGCTTGTATCTTGTGCCATTCTCGAGAATGGCACAAGATACAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-2262s1c1
Sequence:CCGGCCTGGCACAGAGCAACAATTTCTCGAGAAATTGTTGCTCTGTGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-1653s1c1
Sequence:CCGGCCCATGTCCTTATCAGGCAAACTCGAGTTTGCCTGATAAGGACATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003506.2-402s1c1
Sequence:CCGGCCCTAATCTGATGGGTCATTACTCGAGTAATGACCCATCAGATTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008056
VALIDATED
FZD6 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-1133s21c1
Sequence:CCGGACCGTTGTCCTAGGGTCAAAGCTCGAGCTTTGACCCTAGGACAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008056.3-2500s21c1
Sequence:CCGGACCAACTGATTTGTCTTATAACTCGAGTTATAAGACAAATCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-1082s21c1
Sequence:CCGGGGCAATAGCACGGCTTGTAATCTCGAGATTACAAGCCGTGCTATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-445s21c1
Sequence:CCGGCCCTAACCTGATGGGTCATTACTCGAGTAATGACCCATCAGGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-592s21c1
Sequence:CCGGAGTTCTACCCTGTCGGAAATTCTCGAGAATTTCCGACAGGGTAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-435s1c1
Sequence:CCGGCCTAACCTGATGGGTCATTATCTCGAGATAATGACCCATCAGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008056.2-942s1c1
Sequence:CCGGGCAACTCTGTTCACGTTCCTTCTCGAGAAGGAACGTGAACAGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-2254s1c1
Sequence:CCGGCTCCAAGTGAAGGAAGGGTAACTCGAGTTACCCTTCCTTCACTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-1588s1c1
Sequence:CCGGCCTTAGTGACACTTCTCGGTTCTCGAGAACCGAGAAGTGTCACTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008056.2-1713s1c1
Sequence:CCGGGCTCGACCAGAATTGGCTTTACTCGAGTAAAGCCAATTCTGGTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008056
VALIDATED
FZD6 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-1133s21c1
Sequence:CCGGACCGTTGTCCTAGGGTCAAAGCTCGAGCTTTGACCCTAGGACAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008056.3-2500s21c1
Sequence:CCGGACCAACTGATTTGTCTTATAACTCGAGTTATAAGACAAATCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-1082s21c1
Sequence:CCGGGGCAATAGCACGGCTTGTAATCTCGAGATTACAAGCCGTGCTATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-445s21c1
Sequence:CCGGCCCTAACCTGATGGGTCATTACTCGAGTAATGACCCATCAGGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-592s21c1
Sequence:CCGGAGTTCTACCCTGTCGGAAATTCTCGAGAATTTCCGACAGGGTAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-435s1c1
Sequence:CCGGCCTAACCTGATGGGTCATTATCTCGAGATAATGACCCATCAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008056.2-942s1c1
Sequence:CCGGGCAACTCTGTTCACGTTCCTTCTCGAGAAGGAACGTGAACAGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-2254s1c1
Sequence:CCGGCTCCAAGTGAAGGAAGGGTAACTCGAGTTACCCTTCCTTCACTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-1588s1c1
Sequence:CCGGCCTTAGTGACACTTCTCGGTTCTCGAGAACCGAGAAGTGTCACTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008056.2-1713s1c1
Sequence:CCGGGCTCGACCAGAATTGGCTTTACTCGAGTAAAGCCAATTCTGGTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008056
VALIDATED
FZD6 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-1133s21c1
Sequence:CCGGACCGTTGTCCTAGGGTCAAAGCTCGAGCTTTGACCCTAGGACAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008056.3-2500s21c1
Sequence:CCGGACCAACTGATTTGTCTTATAACTCGAGTTATAAGACAAATCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-1082s21c1
Sequence:CCGGGGCAATAGCACGGCTTGTAATCTCGAGATTACAAGCCGTGCTATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-445s21c1
Sequence:CCGGCCCTAACCTGATGGGTCATTACTCGAGTAATGACCCATCAGGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008056.3-592s21c1
Sequence:CCGGAGTTCTACCCTGTCGGAAATTCTCGAGAATTTCCGACAGGGTAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-435s1c1
Sequence:CCGGCCTAACCTGATGGGTCATTATCTCGAGATAATGACCCATCAGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008056.2-942s1c1
Sequence:CCGGGCAACTCTGTTCACGTTCCTTCTCGAGAAGGAACGTGAACAGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-2254s1c1
Sequence:CCGGCTCCAAGTGAAGGAAGGGTAACTCGAGTTACCCTTCCTTCACTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008056.2-1588s1c1
Sequence:CCGGCCTTAGTGACACTTCTCGGTTCTCGAGAACCGAGAAGTGTCACTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008056.2-1713s1c1
Sequence:CCGGGCTCGACCAGAATTGGCTTTACTCGAGTAAAGCCAATTCTGGTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)