EMAIL THIS PAGE TO A FRIEND

FZD7

frizzled family receptor 7

163 Gene Product Result for
Synonyms: FzE3
UniProtKB ID: O75084, O94816, Q53S59, Q96B74
Gene ID:
Human(8324) Summary: Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD7 protein contains an N-terminal signal sequence, 10 cysteine residues typical of the cysteine-rich extracellular domain of Fz family members, 7 putative transmembrane domains, and an intracellular C-terminal tail with a PDZ domain-binding motif. FZD7 gene expression may downregulate APC function and enhance beta-catenin-mediated signals in poorly differentiated human esophageal carcinomas. [provided by RefSeq, Jul 2008]
Mouse(14369) frizzled homolog 7 (Drosophila)
Rat(301440) frizzled family receptor 7
sheep(101103546) frizzled family receptor 7
domestic guinea pig(100735394) frizzled family receptor 7
naked mole-rat(101704351) frizzled family receptor 7
chicken(374060) frizzled family receptor 7
cow(524255) frizzled family receptor 7
domestic cat(101087255) frizzled family receptor 7
dog(488478) frizzled family receptor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121641 MISSION® esiRNA esiRNA human FZD7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003507 Rosetta Predictions human pricing
XM_001069570 Rosetta Predictions rat pricing
XM_237191 Rosetta Predictions rat pricing
NM_008057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230687 predicted 2052
2 SASI_Hs01_00230688 predicted 1500
3 SASI_Hs01_00230689 predicted 2013
4 SASI_Hs01_00230690 predicted 2267
5 SASI_Hs01_00230691 predicted 1966
6 SASI_Hs01_00230692 predicted 526
7 SASI_Hs01_00230693 predicted 1969
8 SASI_Hs01_00230694 predicted 1906
9 SASI_Hs01_00230695 predicted 2260
10 SASI_Hs01_00230696 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328512 predicted 1759
2 SASI_Rn02_00328513 predicted 1176
3 SASI_Rn02_00328514 predicted 1185
4 SASI_Rn02_00328515 predicted 592
5 SASI_Rn02_00328516 predicted 2633
6 SASI_Rn02_00328517 predicted 1585
7 SASI_Rn02_00328518 predicted 2581
8 SASI_Rn02_00328519 predicted 2922
9 SASI_Rn02_00328520 predicted 1623
10 SASI_Rn02_00328521 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390707 predicted 2178
2 SASI_Rn02_00390708 predicted 1586
3 SASI_Rn02_00390709 predicted 1600
4 SASI_Rn02_00390710 predicted 2390
5 SASI_Rn02_00390711 predicted 1506
6 SASI_Rn02_00390712 predicted 1015
7 SASI_Rn02_00390713 predicted 299
8 SASI_Rn02_00390714 predicted 1304
9 SASI_Rn02_00390715 predicted 1505
10 SASI_Rn02_00390716 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177975 predicted 1102
2 SASI_Mm02_00313039 predicted 1865
3 SASI_Mm01_00177976 predicted 915
4 SASI_Mm01_00177977 predicted 2255
5 SASI_Mm01_00177978 predicted 1970
6 SASI_Mm01_00177980 predicted 910
7 SASI_Mm01_00177981 predicted 2071
8 SASI_Mm01_00177982 predicted 1829
9 SASI_Mm01_00177983 predicted 3019
10 SASI_Mm01_00177984 predicted 2811
11 SASI_Mm01_00177979 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003507
FZD7 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003507.1-3391s1c1
Sequence:CCGGGCAGAGAATCATGGGAGCTAACTCGAGTTAGCTCCCATGATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-781s1c1
Sequence:CCGGCGGCCTGATGTACTTTAAGGACTCGAGTCCTTAAAGTACATCAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-157s1c1
Sequence:CCGGGCAGCCGTACCACGGAGAGAACTCGAGTTCTCTCCGTGGTACGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-1657s1c1
Sequence:CCGGCAAGTACCTGATGACCATGATCTCGAGATCATGGTCATCAGGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-1346s1c1
Sequence:CCGGCTGTTCGTCTACCTCTTCATACTCGAGTATGAAGAGGTAGACGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003507.1-1867s21c1
Sequence:CCGGGGGCCTGTTTCTGTAACTTTCCTCGAGGAAAGTTACAGAAACAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003507.1-1735s21c1
Sequence:CCGGCCGCTTCTACCACAGACTTAGCTCGAGCTAAGTCTGTGGTAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003507.1-778s21c1
Sequence:CCGGCAACGGCCTGATGTACTTTAACTCGAGTTAAAGTACATCAGGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003507.1-2030s21c1
Sequence:CCGGCGGCGATGTGAATCGTCAAAGCTCGAGCTTTGACGATTCACATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003507
FZD7 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003507.1-3391s1c1
Sequence:CCGGGCAGAGAATCATGGGAGCTAACTCGAGTTAGCTCCCATGATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-781s1c1
Sequence:CCGGCGGCCTGATGTACTTTAAGGACTCGAGTCCTTAAAGTACATCAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-157s1c1
Sequence:CCGGGCAGCCGTACCACGGAGAGAACTCGAGTTCTCTCCGTGGTACGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-1657s1c1
Sequence:CCGGCAAGTACCTGATGACCATGATCTCGAGATCATGGTCATCAGGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-1346s1c1
Sequence:CCGGCTGTTCGTCTACCTCTTCATACTCGAGTATGAAGAGGTAGACGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003507.1-1867s21c1
Sequence:CCGGGGGCCTGTTTCTGTAACTTTCCTCGAGGAAAGTTACAGAAACAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003507.1-1735s21c1
Sequence:CCGGCCGCTTCTACCACAGACTTAGCTCGAGCTAAGTCTGTGGTAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003507.1-778s21c1
Sequence:CCGGCAACGGCCTGATGTACTTTAACTCGAGTTAAAGTACATCAGGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003507.1-2030s21c1
Sequence:CCGGCGGCGATGTGAATCGTCAAAGCTCGAGCTTTGACGATTCACATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003507
FZD7 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003507.1-3391s1c1
Sequence:CCGGGCAGAGAATCATGGGAGCTAACTCGAGTTAGCTCCCATGATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-781s1c1
Sequence:CCGGCGGCCTGATGTACTTTAAGGACTCGAGTCCTTAAAGTACATCAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-157s1c1
Sequence:CCGGGCAGCCGTACCACGGAGAGAACTCGAGTTCTCTCCGTGGTACGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-1657s1c1
Sequence:CCGGCAAGTACCTGATGACCATGATCTCGAGATCATGGTCATCAGGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003507.1-1346s1c1
Sequence:CCGGCTGTTCGTCTACCTCTTCATACTCGAGTATGAAGAGGTAGACGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003507.1-1867s21c1
Sequence:CCGGGGGCCTGTTTCTGTAACTTTCCTCGAGGAAAGTTACAGAAACAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003507.1-1735s21c1
Sequence:CCGGCCGCTTCTACCACAGACTTAGCTCGAGCTAAGTCTGTGGTAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003507.1-778s21c1
Sequence:CCGGCAACGGCCTGATGTACTTTAACTCGAGTTAAAGTACATCAGGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003507.1-2030s21c1
Sequence:CCGGCGGCGATGTGAATCGTCAAAGCTCGAGCTTTGACGATTCACATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008057
VALIDATED
FZD7 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-430s1c1
Sequence:CCGGCCTGAGCTACGCTTCTTCTTACTCGAGTAAGAAGAAGCGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-241s1c1
Sequence:CCGGCAGCCATATCACGGCGAGAAACTCGAGTTTCTCGCCGTGATATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1380s1c1
Sequence:CCGGCCTGTCTAGTGTGGATGCATTCTCGAGAATGCATCCACACTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1152s1c1
Sequence:CCGGCCTCTTCATGGTGCTTTACTTCTCGAGAAGTAAAGCACCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1306s1c1
Sequence:CCGGGCGGTCAAGACAATCACCATTCTCGAGAATGGTGATTGTCTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-2257s21c1
Sequence:CCGGATCGTGTTGGCCTGCTACTTTCTCGAGAAAGTAGCAGGCCAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008057.3-1931s21c1
Sequence:CCGGAGGCCAACTCGCAGTACTTTCCTCGAGGAAAGTACTGCGAGTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-1523s21c1
Sequence:CCGGCTAACGGCCTCATGTACTTTACTCGAGTAAAGTACATGAGGCCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008057.3-3071s21c1
Sequence:CCGGTGGAGCCCAGATGGGTTAATTCTCGAGAATTAACCCATCTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-2417s21c1
Sequence:CCGGCCATGATCGTGGGCATCACTACTCGAGTAGTGATGCCCACGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008057
VALIDATED
FZD7 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-430s1c1
Sequence:CCGGCCTGAGCTACGCTTCTTCTTACTCGAGTAAGAAGAAGCGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-241s1c1
Sequence:CCGGCAGCCATATCACGGCGAGAAACTCGAGTTTCTCGCCGTGATATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1380s1c1
Sequence:CCGGCCTGTCTAGTGTGGATGCATTCTCGAGAATGCATCCACACTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1152s1c1
Sequence:CCGGCCTCTTCATGGTGCTTTACTTCTCGAGAAGTAAAGCACCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1306s1c1
Sequence:CCGGGCGGTCAAGACAATCACCATTCTCGAGAATGGTGATTGTCTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-2257s21c1
Sequence:CCGGATCGTGTTGGCCTGCTACTTTCTCGAGAAAGTAGCAGGCCAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008057.3-1931s21c1
Sequence:CCGGAGGCCAACTCGCAGTACTTTCCTCGAGGAAAGTACTGCGAGTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-1523s21c1
Sequence:CCGGCTAACGGCCTCATGTACTTTACTCGAGTAAAGTACATGAGGCCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008057.3-3071s21c1
Sequence:CCGGTGGAGCCCAGATGGGTTAATTCTCGAGAATTAACCCATCTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-2417s21c1
Sequence:CCGGCCATGATCGTGGGCATCACTACTCGAGTAGTGATGCCCACGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008057
VALIDATED
FZD7 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-430s1c1
Sequence:CCGGCCTGAGCTACGCTTCTTCTTACTCGAGTAAGAAGAAGCGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-241s1c1
Sequence:CCGGCAGCCATATCACGGCGAGAAACTCGAGTTTCTCGCCGTGATATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1380s1c1
Sequence:CCGGCCTGTCTAGTGTGGATGCATTCTCGAGAATGCATCCACACTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1152s1c1
Sequence:CCGGCCTCTTCATGGTGCTTTACTTCTCGAGAAGTAAAGCACCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008057.2-1306s1c1
Sequence:CCGGGCGGTCAAGACAATCACCATTCTCGAGAATGGTGATTGTCTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-2257s21c1
Sequence:CCGGATCGTGTTGGCCTGCTACTTTCTCGAGAAAGTAGCAGGCCAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008057.3-1931s21c1
Sequence:CCGGAGGCCAACTCGCAGTACTTTCCTCGAGGAAAGTACTGCGAGTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-1523s21c1
Sequence:CCGGCTAACGGCCTCATGTACTTTACTCGAGTAAAGTACATGAGGCCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008057.3-3071s21c1
Sequence:CCGGTGGAGCCCAGATGGGTTAATTCTCGAGAATTAACCCATCTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008057.3-2417s21c1
Sequence:CCGGCCATGATCGTGGGCATCACTACTCGAGTAGTGATGCCCACGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks