EMAIL THIS PAGE TO A FRIEND

FZD8

frizzled family receptor 8

Synonyms: FZ-8 hFZ8
UniProtKB ID: Q9H461
Gene ID:
Human(8325) Summary: This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
Mouse(14370) frizzled homolog 8 (Drosophila)
Rat(364754) frizzled family receptor 8
chicken(374059) frizzled homolog 8 (Drosophila)
domestic cat(101101229) frizzled family receptor 8
cow(616913) frizzled family receptor 8
naked mole-rat(101712115) frizzled family receptor 8
domestic guinea pig(100719503) frizzled family receptor 8
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031866 Rosetta Predictions human pricing
NM_001044251 Rosetta Predictions rat pricing
NM_008058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037014 predicted 2372
2 SASI_Hs01_00037015 predicted 1604
3 SASI_Hs01_00037016 predicted 2427
4 SASI_Hs01_00037017 predicted 1335
5 SASI_Hs01_00037018 predicted 233
6 SASI_Hs01_00037019 predicted 2338
7 SASI_Hs01_00037020 predicted 2408
8 SASI_Hs01_00037023 predicted 2200
9 SASI_Hs02_00358986 predicted 152
10 SASI_Hs02_00358987 predicted 2238
11 SASI_Hs01_00037021 predicted 2337
12 SASI_Hs01_00037022 predicted 2580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205237 predicted 2406
2 SASI_Rn02_00205238 predicted 2440
3 SASI_Rn02_00205239 predicted 392
4 SASI_Rn02_00205240 predicted 1664
5 SASI_Rn02_00205241 predicted 2451
6 SASI_Rn02_00205242 predicted 2602
7 SASI_Rn02_00205243 predicted 2548
8 SASI_Rn02_00205244 predicted 2405
9 SASI_Rn02_00205245 predicted 2419
10 SASI_Rn02_00205246 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024412 predicted 1551
2 SASI_Mm01_00024413 predicted 722
3 SASI_Mm02_00313040 predicted 239
4 SASI_Mm01_00024414 predicted 1455
5 SASI_Mm01_00024416 predicted 1541
6 SASI_Mm01_00024417 predicted 1728
7 SASI_Mm01_00024418 predicted 1514
8 SASI_Mm01_00024419 predicted 1411
9 SASI_Mm01_00024420 predicted 1492
10 SASI_Mm01_00024421 predicted 1759
11 SASI_Mm01_00024415 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031866
FZD8 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031866.2-2046s21c1
Sequence:CCGGAGCTCCGTGTCTTATCCAAAGCTCGAGCTTTGGATAAGACACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031866.2-887s21c1
Sequence:CCGGCACCGTCTCCACCTTCCTTATCTCGAGATAAGGAAGGTGGAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031866.2-2232s21c1
Sequence:CCGGTCCATTAGCTGGGACTTAAATCTCGAGATTTAAGTCCCAGCTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031866.2-2195s21c1
Sequence:CCGGTGATTGCTATTAGCATGATAACTCGAGTTATCATGCTAATAGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-743s1c1
Sequence:CCGGCCCGCTCTACAACCGCGTCAACTCGAGTTGACGCGGTTGTAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-1469s1c1
Sequence:CCGGGCTGGTCATCTACCTCTTCATCTCGAGATGAAGAGGTAGATGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-2051s1c1
Sequence:CCGGCGTGTCTTATCCAAAGCAGATCTCGAGATCTGCTTTGGATAAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-143s1c1
Sequence:CCGGCGGCTACAACTACACCTACATCTCGAGATGTAGGTGTAGTTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031866.1-2381s1c1
Sequence:CCGGCGTTTCCAGAACCCGAGATTTCTCGAGAAATCTCGGGTTCTGGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031866
FZD8 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031866.2-2046s21c1
Sequence:CCGGAGCTCCGTGTCTTATCCAAAGCTCGAGCTTTGGATAAGACACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031866.2-887s21c1
Sequence:CCGGCACCGTCTCCACCTTCCTTATCTCGAGATAAGGAAGGTGGAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031866.2-2232s21c1
Sequence:CCGGTCCATTAGCTGGGACTTAAATCTCGAGATTTAAGTCCCAGCTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031866.2-2195s21c1
Sequence:CCGGTGATTGCTATTAGCATGATAACTCGAGTTATCATGCTAATAGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-743s1c1
Sequence:CCGGCCCGCTCTACAACCGCGTCAACTCGAGTTGACGCGGTTGTAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-1469s1c1
Sequence:CCGGGCTGGTCATCTACCTCTTCATCTCGAGATGAAGAGGTAGATGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-2051s1c1
Sequence:CCGGCGTGTCTTATCCAAAGCAGATCTCGAGATCTGCTTTGGATAAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-143s1c1
Sequence:CCGGCGGCTACAACTACACCTACATCTCGAGATGTAGGTGTAGTTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031866.1-2381s1c1
Sequence:CCGGCGTTTCCAGAACCCGAGATTTCTCGAGAAATCTCGGGTTCTGGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031866
FZD8 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031866.2-2046s21c1
Sequence:CCGGAGCTCCGTGTCTTATCCAAAGCTCGAGCTTTGGATAAGACACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031866.2-887s21c1
Sequence:CCGGCACCGTCTCCACCTTCCTTATCTCGAGATAAGGAAGGTGGAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031866.2-2232s21c1
Sequence:CCGGTCCATTAGCTGGGACTTAAATCTCGAGATTTAAGTCCCAGCTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031866.2-2195s21c1
Sequence:CCGGTGATTGCTATTAGCATGATAACTCGAGTTATCATGCTAATAGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-743s1c1
Sequence:CCGGCCCGCTCTACAACCGCGTCAACTCGAGTTGACGCGGTTGTAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-1469s1c1
Sequence:CCGGGCTGGTCATCTACCTCTTCATCTCGAGATGAAGAGGTAGATGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-2051s1c1
Sequence:CCGGCGTGTCTTATCCAAAGCAGATCTCGAGATCTGCTTTGGATAAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031866.1-143s1c1
Sequence:CCGGCGGCTACAACTACACCTACATCTCGAGATGTAGGTGTAGTTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031866.1-2381s1c1
Sequence:CCGGCGTTTCCAGAACCCGAGATTTCTCGAGAAATCTCGGGTTCTGGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008058
VALIDATED
FZD8 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 8
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1540s21c1
Sequence:CCGGCAGCAAGGAGGTCCAACTAAGCTCGAGCTTAGTTGGACCTCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.2-995s21c1
Sequence:CCGGATATTCCTCTCCGCCTGTTACCTCGAGGTAACAGGCGGAGAGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1743s21c1
Sequence:CCGGCGCGGTCTTCATGCTCAAGTACTCGAGTACTTGAGCATGAAGACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1468s21c1
Sequence:CCGGTACCTCTTCATTGGGACTATGCTCGAGCATAGTCCCAATGAAGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-136s21c1
Sequence:CCGGATCGGTTACAACTACACTTACCTCGAGGTAAGTGTAGTTGTAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.2-2072s21c1
Sequence:CCGGACGGCCAGCTCTGTATCTTACCTCGAGGTAAGATACAGAGCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-891s21c1
Sequence:CCGGCATCGATATGGAGCGCTTTAACTCGAGTTAAAGCGCTCCATATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008058.2-2573s21c1
Sequence:CCGGGACCAGGCAGATGCCTTAAATCTCGAGATTTAAGGCATCTGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008058.1-1470s1c1
Sequence:CCGGCCTCTTCATTGGGACTATGTTCTCGAGAACATAGTCCCAATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-1525s1c1
Sequence:CCGGCGTTCAGTCATCAAGCAGCAACTCGAGTTGCTGCTTGATGACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-134s1c1
Sequence:CCGGGCATCGGTTACAACTACACTTCTCGAGAAGTGTAGTTGTAACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008058.1-889s1c1
Sequence:CCGGCTCATCGATATGGAGCGCTTTCTCGAGAAAGCGCTCCATATCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-1743s1c1
Sequence:CCGGCGCGGTCTTCATGCTCAAGTACTCGAGTACTTGAGCATGAAGACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008058
VALIDATED
FZD8 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 8
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1540s21c1
Sequence:CCGGCAGCAAGGAGGTCCAACTAAGCTCGAGCTTAGTTGGACCTCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.2-995s21c1
Sequence:CCGGATATTCCTCTCCGCCTGTTACCTCGAGGTAACAGGCGGAGAGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1743s21c1
Sequence:CCGGCGCGGTCTTCATGCTCAAGTACTCGAGTACTTGAGCATGAAGACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1468s21c1
Sequence:CCGGTACCTCTTCATTGGGACTATGCTCGAGCATAGTCCCAATGAAGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-136s21c1
Sequence:CCGGATCGGTTACAACTACACTTACCTCGAGGTAAGTGTAGTTGTAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.2-2072s21c1
Sequence:CCGGACGGCCAGCTCTGTATCTTACCTCGAGGTAAGATACAGAGCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-891s21c1
Sequence:CCGGCATCGATATGGAGCGCTTTAACTCGAGTTAAAGCGCTCCATATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008058.2-2573s21c1
Sequence:CCGGGACCAGGCAGATGCCTTAAATCTCGAGATTTAAGGCATCTGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008058.1-1470s1c1
Sequence:CCGGCCTCTTCATTGGGACTATGTTCTCGAGAACATAGTCCCAATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-1525s1c1
Sequence:CCGGCGTTCAGTCATCAAGCAGCAACTCGAGTTGCTGCTTGATGACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-134s1c1
Sequence:CCGGGCATCGGTTACAACTACACTTCTCGAGAAGTGTAGTTGTAACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008058.1-889s1c1
Sequence:CCGGCTCATCGATATGGAGCGCTTTCTCGAGAAAGCGCTCCATATCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-1743s1c1
Sequence:CCGGCGCGGTCTTCATGCTCAAGTACTCGAGTACTTGAGCATGAAGACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008058
VALIDATED
FZD8 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 8
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1540s21c1
Sequence:CCGGCAGCAAGGAGGTCCAACTAAGCTCGAGCTTAGTTGGACCTCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.2-995s21c1
Sequence:CCGGATATTCCTCTCCGCCTGTTACCTCGAGGTAACAGGCGGAGAGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1743s21c1
Sequence:CCGGCGCGGTCTTCATGCTCAAGTACTCGAGTACTTGAGCATGAAGACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-1468s21c1
Sequence:CCGGTACCTCTTCATTGGGACTATGCTCGAGCATAGTCCCAATGAAGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-136s21c1
Sequence:CCGGATCGGTTACAACTACACTTACCTCGAGGTAAGTGTAGTTGTAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.2-2072s21c1
Sequence:CCGGACGGCCAGCTCTGTATCTTACCTCGAGGTAAGATACAGAGCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008058.1-891s21c1
Sequence:CCGGCATCGATATGGAGCGCTTTAACTCGAGTTAAAGCGCTCCATATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008058.2-2573s21c1
Sequence:CCGGGACCAGGCAGATGCCTTAAATCTCGAGATTTAAGGCATCTGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008058.1-1470s1c1
Sequence:CCGGCCTCTTCATTGGGACTATGTTCTCGAGAACATAGTCCCAATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-1525s1c1
Sequence:CCGGCGTTCAGTCATCAAGCAGCAACTCGAGTTGCTGCTTGATGACTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-134s1c1
Sequence:CCGGGCATCGGTTACAACTACACTTCTCGAGAAGTGTAGTTGTAACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008058.1-889s1c1
Sequence:CCGGCTCATCGATATGGAGCGCTTTCTCGAGAAAGCGCTCCATATCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008058.1-1743s1c1
Sequence:CCGGCGCGGTCTTCATGCTCAAGTACTCGAGTACTTGAGCATGAAGACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks