EMAIL THIS PAGE TO A FRIEND

FZD9

frizzled family receptor 9

170 Gene Product Result for
Synonyms: CD349 FZD3
UniProtKB ID: O00144
Gene ID:
Human(8326) Summary: Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney. [provided by RefSeq, Jul 2008]
Mouse(14371) frizzled homolog 9 (Drosophila)
Rat(266608) frizzled family receptor 9
Zebrafish(557447) frizzled homolog 9 (Drosophila)
cow(521364) frizzled family receptor 9
domestic cat(101087697) frizzled family receptor 9
dog(489809) frizzled family receptor 9
chicken(373886) frizzled family receptor 9
sheep(101114236) frizzled family receptor 9
domestic guinea pig(100735834) frizzled family receptor 9
naked mole-rat(101708726) frizzled family receptor 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003508 Rosetta Predictions human pricing
NM_153305 Rosetta Predictions rat pricing
NM_010246 Rosetta Predictions mouse pricing
XM_284144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159003 predicted 1125
2 SASI_Hs01_00159004 predicted 2095
3 SASI_Hs01_00159005 predicted 1940
4 SASI_Hs01_00159006 predicted 1607
5 SASI_Hs01_00159007 predicted 1605
6 SASI_Hs01_00159008 predicted 1369
7 SASI_Hs01_00159009 predicted 1803
8 SASI_Hs01_00159010 predicted 1613
9 SASI_Hs01_00159011 predicted 1338
10 SASI_Hs02_00335795 predicted 1031
11 SASI_Hs01_00159012 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114908 predicted 1133
2 SASI_Rn01_00114909 predicted 1427
3 SASI_Rn01_00114910 predicted 1813
4 SASI_Rn02_00268950 predicted 1503
5 SASI_Rn01_00114911 predicted 1423
6 SASI_Rn01_00114912 predicted 1041
7 SASI_Rn01_00114913 predicted 1018
8 SASI_Rn01_00114914 predicted 1149
9 SASI_Rn01_00114916 predicted 1344
10 SASI_Rn01_00114917 predicted 1528
11 SASI_Rn01_00114915 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318126 predicted 1596
2 SASI_Mm02_00318127 predicted 1737
3 SASI_Mm02_00318128 predicted 914
4 SASI_Mm02_00318129 predicted 1281
5 SASI_Mm02_00318130 predicted 1595
6 SASI_Mm02_00318131 predicted 820
7 SASI_Mm02_00318132 predicted 1782
8 SASI_Mm02_00318133 predicted 1403
9 SASI_Mm02_00318134 predicted 1872
10 SASI_Mm02_00318135 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248621 predicted 1603
2 SASI_Mm01_00248622 predicted 1878
3 SASI_Mm01_00248623 predicted 1405
4 SASI_Mm01_00248624 predicted 1746
5 SASI_Mm01_00248625 predicted 1421
6 SASI_Mm01_00248626 predicted 1601
7 SASI_Mm01_00248627 predicted 1790
8 SASI_Mm01_00248628 predicted 1409
9 SASI_Mm01_00248629 predicted 1877
10 SASI_Mm01_00248630 predicted 1716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003508
FZD9 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003508.1-2015s1c1
Sequence:CCGGCACAGGGTCCTAGTGGAGGATCTCGAGATCCTCCACTAGGACCCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1408s1c1
Sequence:CCGGCGTCATCGTTTGCTATGTCTACTCGAGTAGACATAGCAAACGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1294s1c1
Sequence:CCGGCCTCTTCCACATCCGCAAGATCTCGAGATCTTGCGGATGTGGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1123s1c1
Sequence:CCGGCGCGCTCAAGACCATCGTCATCTCGAGATGACGATGGTCTTGAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1744s1c1
Sequence:CCGGCGTGGTCTTGCACATGACTAACTCGAGTTAGTCATGTGCAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1919s21c1
Sequence:CCGGGGCACGCACTGCCACTATAAGCTCGAGCTTATAGTGGCAGTGCGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1811s21c1
Sequence:CCGGGTGTGGAGCTCCAAGACTTTCCTCGAGGAAAGTCTTGGAGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1178s21c1
Sequence:CCGGTTCCTACTGCTCTACTACTTCCTCGAGGAAGTAGTAGAGCAGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003508
FZD9 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003508.1-2015s1c1
Sequence:CCGGCACAGGGTCCTAGTGGAGGATCTCGAGATCCTCCACTAGGACCCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1408s1c1
Sequence:CCGGCGTCATCGTTTGCTATGTCTACTCGAGTAGACATAGCAAACGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1294s1c1
Sequence:CCGGCCTCTTCCACATCCGCAAGATCTCGAGATCTTGCGGATGTGGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1123s1c1
Sequence:CCGGCGCGCTCAAGACCATCGTCATCTCGAGATGACGATGGTCTTGAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1744s1c1
Sequence:CCGGCGTGGTCTTGCACATGACTAACTCGAGTTAGTCATGTGCAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1919s21c1
Sequence:CCGGGGCACGCACTGCCACTATAAGCTCGAGCTTATAGTGGCAGTGCGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1811s21c1
Sequence:CCGGGTGTGGAGCTCCAAGACTTTCCTCGAGGAAAGTCTTGGAGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1178s21c1
Sequence:CCGGTTCCTACTGCTCTACTACTTCCTCGAGGAAGTAGTAGAGCAGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003508
FZD9 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003508.1-2015s1c1
Sequence:CCGGCACAGGGTCCTAGTGGAGGATCTCGAGATCCTCCACTAGGACCCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1408s1c1
Sequence:CCGGCGTCATCGTTTGCTATGTCTACTCGAGTAGACATAGCAAACGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1294s1c1
Sequence:CCGGCCTCTTCCACATCCGCAAGATCTCGAGATCTTGCGGATGTGGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1123s1c1
Sequence:CCGGCGCGCTCAAGACCATCGTCATCTCGAGATGACGATGGTCTTGAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003508.1-1744s1c1
Sequence:CCGGCGTGGTCTTGCACATGACTAACTCGAGTTAGTCATGTGCAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1919s21c1
Sequence:CCGGGGCACGCACTGCCACTATAAGCTCGAGCTTATAGTGGCAGTGCGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1811s21c1
Sequence:CCGGGTGTGGAGCTCCAAGACTTTCCTCGAGGAAAGTCTTGGAGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003508.2-1178s21c1
Sequence:CCGGTTCCTACTGCTCTACTACTTCCTCGAGGAAGTAGTAGAGCAGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010246
FZD9 MISSION shRNA Bacterial Glycerol Stock
frizzled family receptor 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-968s21c1
Sequence:CCGGTCTTCCTGTTGCTCTATTATTCTCGAGAATAATAGAGCAACAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010246.1-1801s21c1
Sequence:CCGGATAGGCTAGGCTGTGAGTTATCTCGAGATAACTCACAGCCTAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-1712s21c1
Sequence:CCGGGTACCCACTGCCACTACAAAGCTCGAGCTTTGTAGTGGCAGTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-1405s21c1
Sequence:CCGGGTCATTGTCTGCTACGTTTATCTCGAGATAAACGTAGCAGACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-827s21c1
Sequence:CCGGTCCTTTCTATGTGCTACAATGCTCGAGCATTGTAGCACATAGAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010246
FZD9 MISSION shRNA shRNA Plasmid DNA
frizzled family receptor 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-968s21c1
Sequence:CCGGTCTTCCTGTTGCTCTATTATTCTCGAGAATAATAGAGCAACAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010246.1-1801s21c1
Sequence:CCGGATAGGCTAGGCTGTGAGTTATCTCGAGATAACTCACAGCCTAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-1712s21c1
Sequence:CCGGGTACCCACTGCCACTACAAAGCTCGAGCTTTGTAGTGGCAGTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-1405s21c1
Sequence:CCGGGTCATTGTCTGCTACGTTTATCTCGAGATAAACGTAGCAGACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-827s21c1
Sequence:CCGGTCCTTTCTATGTGCTACAATGCTCGAGCATTGTAGCACATAGAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010246
FZD9 MISSION shRNA Lentiviral Transduction Particles
frizzled family receptor 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-968s21c1
Sequence:CCGGTCTTCCTGTTGCTCTATTATTCTCGAGAATAATAGAGCAACAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010246.1-1801s21c1
Sequence:CCGGATAGGCTAGGCTGTGAGTTATCTCGAGATAACTCACAGCCTAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-1712s21c1
Sequence:CCGGGTACCCACTGCCACTACAAAGCTCGAGCTTTGTAGTGGCAGTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-1405s21c1
Sequence:CCGGGTCATTGTCTGCTACGTTTATCTCGAGATAAACGTAGCAGACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010246.1-827s21c1
Sequence:CCGGTCCTTTCTATGTGCTACAATGCTCGAGCATTGTAGCACATAGAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks