EMAIL THIS PAGE TO A FRIEND

FZR1

fizzy/cell division cycle 20 related 1 (Drosophila)

84 Gene Product Result for
Synonyms: CDC20C CDH1 FZR FZR2 HCDH HCDH1
Gene ID:
Mouse(56371) fizzy/cell division cycle 20 related 1 (Drosophila)
Rat(314642) fizzy/cell division cycle 20 related 1 (Drosophila)
Zebrafish(393223) fizzy/cell division cycle 20 related 1 (Drosophila)
cow(530333) fizzy/cell division cycle 20 related 1 (Drosophila)
Horse(100061287) fizzy/cell division cycle 20 related 1 (Drosophila)
chicken(373959) fizzy/cell division cycle 20 related 1 (Drosophila)
domestic cat(101088059) fizzy/cell division cycle 20 related 1 (Drosophila)
dog(485059) fizzy/cell division cycle 20 related 1 (Drosophila)
naked mole-rat(101697340) fizzy/cell division cycle 20 related 1 (Drosophila)
domestic guinea pig(100714794) fizzy/cell division cycle 20 related 1 (Drosophila)
sheep(101117072) fizzy/cell division cycle 20 related 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016263 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081001 MISSION® esiRNA esiRNA human FZR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016263 Rosetta Predictions human pricing
NM_001108074 Rosetta Predictions rat pricing
NM_019757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058009 predicted 619
2 SASI_Hs02_00349155 predicted 1286
3 SASI_Hs01_00058010 predicted 776
4 SASI_Hs01_00058011 predicted 1783
5 SASI_Hs02_00349156 predicted 1296
6 SASI_Hs02_00349157 predicted 608
7 SASI_Hs01_00058013 predicted 1671
8 SASI_Hs01_00058014 predicted 1650
9 SASI_Hs01_00058015 predicted 1181
10 SASI_Hs01_00058016 predicted 1503
11 SASI_Hs01_00058012 predicted 416
12 SASI_Hs01_00058017 predicted 276
13 SASI_Hs01_00058018 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235094 predicted 406
2 SASI_Rn02_00235095 predicted 272
3 SASI_Rn02_00235096 predicted 409
4 SASI_Rn02_00235097 predicted 410
5 SASI_Rn02_00235098 predicted 274
6 SASI_Rn02_00235099 predicted 438
7 SASI_Rn02_00235100 predicted 299
8 SASI_Rn02_00235101 predicted 416
9 SASI_Rn02_00235102 predicted 291
10 SASI_Rn02_00235103 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182087 predicted 878
2 SASI_Mm01_00182088 predicted 1366
3 SASI_Mm01_00182089 predicted 527
4 SASI_Mm01_00182090 predicted 1580
5 SASI_Mm01_00182091 predicted 1524
6 SASI_Mm01_00182092 predicted 1598
7 SASI_Mm01_00182093 predicted 981
8 SASI_Mm01_00182094 predicted 390
9 SASI_Mm02_00324929 predicted 518
10 SASI_Mm01_00182095 predicted 1091
11 SASI_Mm01_00182096 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019757
VALIDATED
FZR1 MISSION shRNA Bacterial Glycerol Stock
fizzy/cell division cycle 20 related 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-1157s21c1
Sequence:CCGGGTGTGGAACCACTCTAGTCTACTCGAGTAGACTAGAGTGGTTCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-652s21c1
Sequence:CCGGGATCTCTAAGATTCCCTTCAACTCGAGTTGAAGGGAATCTTAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019757.1-1813s21c1
Sequence:CCGGTGGACACTTGCCACCTGTTACCTCGAGGTAACAGGTGGCAAGTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-316s21c1
Sequence:CCGGCGTGAACTTCCACAGGATCAACTCGAGTTGATCCTGTGGAAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-1016s21c1
Sequence:CCGGATGATCCTACAGCGGGATATCCTCGAGGATATCCCGCTGTAGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-1990s1c1
Sequence:CCGGCTCACCCTGTGACACTCTTAACTCGAGTTAAGAGTGTCACAGGGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-173s1c1
Sequence:CCGGCGGCAGATCATCATCCAGAATCTCGAGATTCTGGATGATGATCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-316s1c1
Sequence:CCGGCGTGAACTTCCACAGGATCAACTCGAGTTGATCCTGTGGAAGTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-652s1c1
Sequence:CCGGGATCTCTAAGATTCCCTTCAACTCGAGTTGAAGGGAATCTTAGAGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019757
VALIDATED
FZR1 MISSION shRNA shRNA Plasmid DNA
fizzy/cell division cycle 20 related 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-1157s21c1
Sequence:CCGGGTGTGGAACCACTCTAGTCTACTCGAGTAGACTAGAGTGGTTCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-652s21c1
Sequence:CCGGGATCTCTAAGATTCCCTTCAACTCGAGTTGAAGGGAATCTTAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019757.1-1813s21c1
Sequence:CCGGTGGACACTTGCCACCTGTTACCTCGAGGTAACAGGTGGCAAGTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-316s21c1
Sequence:CCGGCGTGAACTTCCACAGGATCAACTCGAGTTGATCCTGTGGAAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-1016s21c1
Sequence:CCGGATGATCCTACAGCGGGATATCCTCGAGGATATCCCGCTGTAGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-1990s1c1
Sequence:CCGGCTCACCCTGTGACACTCTTAACTCGAGTTAAGAGTGTCACAGGGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-173s1c1
Sequence:CCGGCGGCAGATCATCATCCAGAATCTCGAGATTCTGGATGATGATCTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-316s1c1
Sequence:CCGGCGTGAACTTCCACAGGATCAACTCGAGTTGATCCTGTGGAAGTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-652s1c1
Sequence:CCGGGATCTCTAAGATTCCCTTCAACTCGAGTTGAAGGGAATCTTAGAGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019757
VALIDATED
FZR1 MISSION shRNA Lentiviral Transduction Particles
fizzy/cell division cycle 20 related 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-1157s21c1
Sequence:CCGGGTGTGGAACCACTCTAGTCTACTCGAGTAGACTAGAGTGGTTCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-652s21c1
Sequence:CCGGGATCTCTAAGATTCCCTTCAACTCGAGTTGAAGGGAATCTTAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019757.1-1813s21c1
Sequence:CCGGTGGACACTTGCCACCTGTTACCTCGAGGTAACAGGTGGCAAGTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-316s21c1
Sequence:CCGGCGTGAACTTCCACAGGATCAACTCGAGTTGATCCTGTGGAAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019757.1-1016s21c1
Sequence:CCGGATGATCCTACAGCGGGATATCCTCGAGGATATCCCGCTGTAGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-1990s1c1
Sequence:CCGGCTCACCCTGTGACACTCTTAACTCGAGTTAAGAGTGTCACAGGGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-173s1c1
Sequence:CCGGCGGCAGATCATCATCCAGAATCTCGAGATTCTGGATGATGATCTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-316s1c1
Sequence:CCGGCGTGAACTTCCACAGGATCAACTCGAGTTGATCCTGTGGAAGTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019757.1-652s1c1
Sequence:CCGGGATCTCTAAGATTCCCTTCAACTCGAGTTGAAGGGAATCTTAGAGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016263
VALIDATED
FZR1 MISSION shRNA Bacterial Glycerol Stock
fizzy/cell division cycle 20 related 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-405s21c1
Sequence:CCGGAGAAGGGTCTGTTCACGTATTCTCGAGAATACGTGAACAGACCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1498s21c1
Sequence:CCGGCTTCACCAGGATCCGGTAAACCTCGAGGTTTACCGGATCCTGGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1652s21c1
Sequence:CCGGGGATCCTGGAGTCTCATTAAACTCGAGTTTAATGAGACTCCAGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1434s21c1
Sequence:CCGGTGAGGTTCTGGAACGTCTTTACTCGAGTAAAGACGTTCCAGAACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-209s21c1
Sequence:CCGGGTGAACTTCCACAGGATTAACCTCGAGGTTAATCCTGTGGAAGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016263.x-3378s1c1
Sequence:CCGGCCAGCCTTGTTTCTCATGTAACTCGAGTTACATGAGAAACAAGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-411s1c1
Sequence:CCGGGTCTGTTCACGTATTCCCTTACTCGAGTAAGGGAATACGTGAACAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-246s1c1
Sequence:CCGGCCAGTCAGAACCGGAAAGCCACTCGAGTGGCTTTCCGGTTCTGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016263.x-457s1c1
Sequence:CCGGCGGCAACGATGTGTCTCCCTACTCGAGTAGGGAGACACATCGTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-1030s1c1
Sequence:CCGGCAACGACAACAAGCTGCTGGTCTCGAGACCAGCAGCTTGTTGTCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016263
VALIDATED
FZR1 MISSION shRNA shRNA Plasmid DNA
fizzy/cell division cycle 20 related 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-405s21c1
Sequence:CCGGAGAAGGGTCTGTTCACGTATTCTCGAGAATACGTGAACAGACCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1498s21c1
Sequence:CCGGCTTCACCAGGATCCGGTAAACCTCGAGGTTTACCGGATCCTGGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1652s21c1
Sequence:CCGGGGATCCTGGAGTCTCATTAAACTCGAGTTTAATGAGACTCCAGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1434s21c1
Sequence:CCGGTGAGGTTCTGGAACGTCTTTACTCGAGTAAAGACGTTCCAGAACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-209s21c1
Sequence:CCGGGTGAACTTCCACAGGATTAACCTCGAGGTTAATCCTGTGGAAGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016263.x-3378s1c1
Sequence:CCGGCCAGCCTTGTTTCTCATGTAACTCGAGTTACATGAGAAACAAGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-411s1c1
Sequence:CCGGGTCTGTTCACGTATTCCCTTACTCGAGTAAGGGAATACGTGAACAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-246s1c1
Sequence:CCGGCCAGTCAGAACCGGAAAGCCACTCGAGTGGCTTTCCGGTTCTGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016263.x-457s1c1
Sequence:CCGGCGGCAACGATGTGTCTCCCTACTCGAGTAGGGAGACACATCGTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-1030s1c1
Sequence:CCGGCAACGACAACAAGCTGCTGGTCTCGAGACCAGCAGCTTGTTGTCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016263
VALIDATED
FZR1 MISSION shRNA Lentiviral Transduction Particles
fizzy/cell division cycle 20 related 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-405s21c1
Sequence:CCGGAGAAGGGTCTGTTCACGTATTCTCGAGAATACGTGAACAGACCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1498s21c1
Sequence:CCGGCTTCACCAGGATCCGGTAAACCTCGAGGTTTACCGGATCCTGGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1652s21c1
Sequence:CCGGGGATCCTGGAGTCTCATTAAACTCGAGTTTAATGAGACTCCAGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-1434s21c1
Sequence:CCGGTGAGGTTCTGGAACGTCTTTACTCGAGTAAAGACGTTCCAGAACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016263.2-209s21c1
Sequence:CCGGGTGAACTTCCACAGGATTAACCTCGAGGTTAATCCTGTGGAAGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016263.x-3378s1c1
Sequence:CCGGCCAGCCTTGTTTCTCATGTAACTCGAGTTACATGAGAAACAAGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-411s1c1
Sequence:CCGGGTCTGTTCACGTATTCCCTTACTCGAGTAAGGGAATACGTGAACAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-246s1c1
Sequence:CCGGCCAGTCAGAACCGGAAAGCCACTCGAGTGGCTTTCCGGTTCTGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016263.x-457s1c1
Sequence:CCGGCGGCAACGATGTGTCTCCCTACTCGAGTAGGGAGACACATCGTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016263.x-1030s1c1
Sequence:CCGGCAACGACAACAAGCTGCTGGTCTCGAGACCAGCAGCTTGTTGTCGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)