EMAIL THIS PAGE TO A FRIEND

G0S2

G0/G1switch 2

63 Gene Product Result for
Synonyms: RP1-28O10.2
UniProtKB ID: P27469, Q6FGC8
Gene ID:
Mouse(14373) G0/G1 switch gene 2
Rat(289388) G0/G1switch 2
chicken(419860) G0/G1switch 2
domestic cat(101088385) G0/G1switch 2
cow(507436) G0/G1switch 2
dog(609704) putative lymphocyte G0/G1 switch protein 2-like
sheep(101121790) G0/G1switch 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015714 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015714 Rosetta Predictions human pricing
NM_001009632 Rosetta Predictions rat pricing
NM_008059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133110 predicted 715
2 SASI_Hs02_00348389 predicted 281
3 SASI_Hs02_00348390 predicted 613
4 SASI_Hs01_00133117 predicted 705
5 SASI_Hs02_00348391 predicted 729
6 SASI_Hs02_00348392 predicted 676
7 SASI_Hs02_00348393 predicted 319
8 SASI_Hs02_00348394 predicted 711
9 SASI_Hs02_00348395 predicted 720
10 SASI_Hs02_00348396 predicted 724
11 SASI_Hs01_00133111 predicted 380
12 SASI_Hs01_00133112 predicted 495
13 SASI_Hs01_00133113 predicted 560
14 SASI_Hs01_00133114 predicted 522
15 SASI_Hs01_00133115 predicted 637
16 SASI_Hs01_00133116 predicted 464
17 SASI_Hs01_00133118 predicted 399
18 SASI_Hs01_00133119 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109114 predicted 328
2 SASI_Rn02_00199640 predicted 326
3 SASI_Rn01_00109115 predicted 342
4 SASI_Rn01_00109116 predicted 324
5 SASI_Rn01_00109118 predicted 384
6 SASI_Rn01_00109119 predicted 392
7 SASI_Rn02_00199641 predicted 386
8 SASI_Rn01_00109120 predicted 257
9 SASI_Rn01_00109121 predicted 414
10 SASI_Rn01_00109122 predicted 229
11 SASI_Rn01_00109117 predicted 224
12 SASI_Rn01_00109123 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313041 predicted 601
2 SASI_Mm02_00313042 predicted 578
3 SASI_Mm02_00313043 predicted 254
4 SASI_Mm02_00313044 predicted 543
5 SASI_Mm02_00313045 predicted 596
6 SASI_Mm01_00075924 predicted 524
7 SASI_Mm02_00313046 predicted 592
8 SASI_Mm01_00075931 predicted 398
9 SASI_Mm02_00313047 predicted 523
10 SASI_Mm02_00313048 predicted 580
11 SASI_Mm01_00075923 predicted 242
12 SASI_Mm01_00075925 predicted 202
13 SASI_Mm01_00075926 predicted 218
14 SASI_Mm01_00075927 predicted 329
15 SASI_Mm01_00075928 predicted 294
16 SASI_Mm01_00075929 predicted 293
17 SASI_Mm01_00075930 predicted 270
18 SASI_Mm01_00075932 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008059
VALIDATED
G0S2 MISSION shRNA Bacterial Glycerol Stock
G0/G1switch 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-190s1c1
Sequence:CCGGCGAGGGAAGCTAGTGAAGCTACTCGAGTAGCTTCACTAGCTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-316s1c1
Sequence:CCGGGCAGTGGTGGAGCTGCGGGAACTCGAGTTCCCGCAGCTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-342s1c1
Sequence:CCGGTGAACAGCAGTCCCTCCACAACTCGAGTTGTGGAGGGACTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008059.1-492s1c1
Sequence:CCGGGCAACAGAGTCACATGCTGTTCTCGAGAACAGCATGTGACTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008059.1-198s1c1
Sequence:CCGGGCTAGTGAAGCTATACGTTCTCTCGAGAGAACGTATAGCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-289s21c1
Sequence:CCGGGGGAAGCTAGTGAAGCTATACCTCGAGGTATAGCTTCACTAGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008059.3-658s21c1
Sequence:CCGGGTCTGGGACTGATTTGCTGCTCTCGAGAGCAGCAAATCAGTCCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-557s21c1
Sequence:CCGGAGAAGGGAGACACAGATCATGCTCGAGCATGATCTGTGTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-606s21c1
Sequence:CCGGGTTTCAAGGTGCCACCGAATCCTCGAGGATTCGGTGGCACCTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-546s21c1
Sequence:CCGGGTGACTGACAGAGAAGGGAGACTCGAGTCTCCCTTCTCTGTCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008059.3-359s21c1
Sequence:CCGGAGACGGTGTGCAGCCCTTTCACTCGAGTGAAAGGGCTGCACACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-339s21c1
Sequence:CCGGTGTGGTGCTCGGCCTAGTTGACTCGAGTCAACTAGGCCGAGCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008059
VALIDATED
G0S2 MISSION shRNA shRNA Plasmid DNA
G0/G1switch 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-190s1c1
Sequence:CCGGCGAGGGAAGCTAGTGAAGCTACTCGAGTAGCTTCACTAGCTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-316s1c1
Sequence:CCGGGCAGTGGTGGAGCTGCGGGAACTCGAGTTCCCGCAGCTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-342s1c1
Sequence:CCGGTGAACAGCAGTCCCTCCACAACTCGAGTTGTGGAGGGACTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008059.1-492s1c1
Sequence:CCGGGCAACAGAGTCACATGCTGTTCTCGAGAACAGCATGTGACTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008059.1-198s1c1
Sequence:CCGGGCTAGTGAAGCTATACGTTCTCTCGAGAGAACGTATAGCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-289s21c1
Sequence:CCGGGGGAAGCTAGTGAAGCTATACCTCGAGGTATAGCTTCACTAGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008059.3-658s21c1
Sequence:CCGGGTCTGGGACTGATTTGCTGCTCTCGAGAGCAGCAAATCAGTCCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-557s21c1
Sequence:CCGGAGAAGGGAGACACAGATCATGCTCGAGCATGATCTGTGTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-606s21c1
Sequence:CCGGGTTTCAAGGTGCCACCGAATCCTCGAGGATTCGGTGGCACCTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-546s21c1
Sequence:CCGGGTGACTGACAGAGAAGGGAGACTCGAGTCTCCCTTCTCTGTCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008059.3-359s21c1
Sequence:CCGGAGACGGTGTGCAGCCCTTTCACTCGAGTGAAAGGGCTGCACACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-339s21c1
Sequence:CCGGTGTGGTGCTCGGCCTAGTTGACTCGAGTCAACTAGGCCGAGCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008059
VALIDATED
G0S2 MISSION shRNA Lentiviral Transduction Particles
G0/G1switch 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-190s1c1
Sequence:CCGGCGAGGGAAGCTAGTGAAGCTACTCGAGTAGCTTCACTAGCTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-316s1c1
Sequence:CCGGGCAGTGGTGGAGCTGCGGGAACTCGAGTTCCCGCAGCTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008059.1-342s1c1
Sequence:CCGGTGAACAGCAGTCCCTCCACAACTCGAGTTGTGGAGGGACTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008059.1-492s1c1
Sequence:CCGGGCAACAGAGTCACATGCTGTTCTCGAGAACAGCATGTGACTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008059.1-198s1c1
Sequence:CCGGGCTAGTGAAGCTATACGTTCTCTCGAGAGAACGTATAGCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-289s21c1
Sequence:CCGGGGGAAGCTAGTGAAGCTATACCTCGAGGTATAGCTTCACTAGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008059.3-658s21c1
Sequence:CCGGGTCTGGGACTGATTTGCTGCTCTCGAGAGCAGCAAATCAGTCCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-557s21c1
Sequence:CCGGAGAAGGGAGACACAGATCATGCTCGAGCATGATCTGTGTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-606s21c1
Sequence:CCGGGTTTCAAGGTGCCACCGAATCCTCGAGGATTCGGTGGCACCTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-546s21c1
Sequence:CCGGGTGACTGACAGAGAAGGGAGACTCGAGTCTCCCTTCTCTGTCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008059.3-359s21c1
Sequence:CCGGAGACGGTGTGCAGCCCTTTCACTCGAGTGAAAGGGCTGCACACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008059.3-339s21c1
Sequence:CCGGTGTGGTGCTCGGCCTAGTTGACTCGAGTCAACTAGGCCGAGCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015714
G0S2 MISSION shRNA Bacterial Glycerol Stock
G0/G1switch 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-724s1c1
Sequence:CCGGCATTTCCAACACTGTGTGAATCTCGAGATTCACACAGTGTTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-712s1c1
Sequence:CCGGGCATTGTCATGACATTTCCAACTCGAGTTGGAAATGTCATGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-708s1c1
Sequence:CCGGCACTGCATTGTCATGACATTTCTCGAGAAATGTCATGACAATGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-636s1c1
Sequence:CCGGGCTGACATCTAGAACTGACCTCTCGAGAGGTCAGTTCTAGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-707s1c1
Sequence:CCGGGCACTGCATTGTCATGACATTCTCGAGAATGTCATGACAATGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-759s21c1
Sequence:CCGGAGCATCCACCAAAGGAGTTTGCTCGAGCAAACTCCTTTGGTGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-708s21c1
Sequence:CCGGTTTGGACTTAACTTCAGAGAACTCGAGTTCTCTGAAGTTAAGTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015714.3-323s21c1
Sequence:CCGGGATGGTGAAGCTGTACGTGCTCTCGAGAGCACGTACAGCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-619s21c1
Sequence:CCGGAGACCGAGAGAGGAATGGAGACTCGAGTCTCCATTCCTCTCTCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015714
G0S2 MISSION shRNA shRNA Plasmid DNA
G0/G1switch 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-724s1c1
Sequence:CCGGCATTTCCAACACTGTGTGAATCTCGAGATTCACACAGTGTTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-712s1c1
Sequence:CCGGGCATTGTCATGACATTTCCAACTCGAGTTGGAAATGTCATGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-708s1c1
Sequence:CCGGCACTGCATTGTCATGACATTTCTCGAGAAATGTCATGACAATGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-636s1c1
Sequence:CCGGGCTGACATCTAGAACTGACCTCTCGAGAGGTCAGTTCTAGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-707s1c1
Sequence:CCGGGCACTGCATTGTCATGACATTCTCGAGAATGTCATGACAATGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-759s21c1
Sequence:CCGGAGCATCCACCAAAGGAGTTTGCTCGAGCAAACTCCTTTGGTGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-708s21c1
Sequence:CCGGTTTGGACTTAACTTCAGAGAACTCGAGTTCTCTGAAGTTAAGTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015714.3-323s21c1
Sequence:CCGGGATGGTGAAGCTGTACGTGCTCTCGAGAGCACGTACAGCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-619s21c1
Sequence:CCGGAGACCGAGAGAGGAATGGAGACTCGAGTCTCCATTCCTCTCTCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015714
G0S2 MISSION shRNA Lentiviral Transduction Particles
G0/G1switch 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-724s1c1
Sequence:CCGGCATTTCCAACACTGTGTGAATCTCGAGATTCACACAGTGTTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-712s1c1
Sequence:CCGGGCATTGTCATGACATTTCCAACTCGAGTTGGAAATGTCATGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-708s1c1
Sequence:CCGGCACTGCATTGTCATGACATTTCTCGAGAAATGTCATGACAATGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-636s1c1
Sequence:CCGGGCTGACATCTAGAACTGACCTCTCGAGAGGTCAGTTCTAGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015714.2-707s1c1
Sequence:CCGGGCACTGCATTGTCATGACATTCTCGAGAATGTCATGACAATGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-759s21c1
Sequence:CCGGAGCATCCACCAAAGGAGTTTGCTCGAGCAAACTCCTTTGGTGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-708s21c1
Sequence:CCGGTTTGGACTTAACTTCAGAGAACTCGAGTTCTCTGAAGTTAAGTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015714.3-323s21c1
Sequence:CCGGGATGGTGAAGCTGTACGTGCTCTCGAGAGCACGTACAGCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015714.3-619s21c1
Sequence:CCGGAGACCGAGAGAGGAATGGAGACTCGAGTCTCCATTCCTCTCTCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks