EMAIL THIS PAGE TO A FRIEND

G2E3

G2/M-phase specific E3 ubiquitin protein ligase

69 Gene Product Result for
Synonyms: KIAA1333 PHF7B
UniProtKB ID: Q7L622, Q9BVR2, Q9H9E9, Q9NXC0, Q9P2L3
Gene ID:
Mouse(217558) G2/M-phase specific E3 ubiquitin ligase
Rat(299002) G2/M-phase specific E3 ubiquitin protein ligase
Zebrafish(368848) G2/M-phase specific E3 ubiquitin ligase
cow(508575) G2/M-phase specific E3 ubiquitin protein ligase
dog(490639) G2/M-phase specific E3 ubiquitin protein ligase
Horse(100049939) G2/M-phase specific E3 ubiquitin protein ligase
domestic cat(101086236) G2/M-phase specific E3 ubiquitin protein ligase
chicken(423305) G2/M-phase specific E3 ubiquitin protein ligase
domestic guinea pig(100713535) G2/M-phase specific E3 ubiquitin protein ligase
sheep(101114906) G2/M-phase specific E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017769 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001015099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001015099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001015099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017769 Rosetta Predictions human pricing
NM_001106726 Rosetta Predictions rat pricing
NM_001015099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350602 predicted 1423
2 SASI_Hs01_00018785 predicted 1567
3 SASI_Hs01_00018786 predicted 788
4 SASI_Hs02_00350603 predicted 2080
5 SASI_Hs01_00018787 predicted 206
6 SASI_Hs01_00018788 predicted 2174
7 SASI_Hs02_00350604 predicted 1907
8 SASI_Hs01_00018791 predicted 311
9 SASI_Hs01_00018793 predicted 836
10 SASI_Hs01_00018794 predicted 818
11 SASI_Hs01_00018789 predicted 1400
12 SASI_Hs01_00018790 predicted 430
13 SASI_Hs01_00018792 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221788 predicted 1302
2 SASI_Rn02_00221789 predicted 470
3 SASI_Rn02_00221790 predicted 1159
4 SASI_Rn02_00221791 predicted 328
5 SASI_Rn02_00221792 predicted 199
6 SASI_Rn02_00221793 predicted 2136
7 SASI_Rn02_00221794 predicted 2169
8 SASI_Rn02_00221795 predicted 2185
9 SASI_Rn02_00221796 predicted 539
10 SASI_Rn02_00221797 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083345 predicted 899
2 SASI_Mm01_00083346 predicted 480
3 SASI_Mm01_00083347 predicted 2237
4 SASI_Mm01_00083348 predicted 1619
5 SASI_Mm01_00083349 predicted 545
6 SASI_Mm01_00083350 predicted 1828
7 SASI_Mm01_00083353 predicted 1687
8 SASI_Mm01_00083354 predicted 2182
9 SASI_Mm02_00287455 predicted 1940
10 SASI_Mm02_00287456 predicted 1548
11 SASI_Mm01_00083351 predicted 212
12 SASI_Mm01_00083352 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017769
VALIDATED
G2E3 MISSION shRNA Bacterial Glycerol Stock
G2/M-phase specific E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-2077s21c1
Sequence:CCGGCATTCCTCCAGCTGGATTTAACTCGAGTTAAATCCAGCTGGAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1409s21c1
Sequence:CCGGCATCTTGAGAACTCATCATTGCTCGAGCAATGATGAGTTCTCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-446s21c1
Sequence:CCGGTGTAAACGAAGTTATCATTTCCTCGAGGAAATGATAACTTCGTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1194s21c1
Sequence:CCGGCAACACTATTAATAGAGTTAGCTCGAGCTAACTCTATTAATAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-716s21c1
Sequence:CCGGAGGTGTACAATATGCAATAATCTCGAGATTATTGCATATTGTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1734s21c1
Sequence:CCGGTCAGACTTATAACGACATTAACTCGAGTTAATGTCGTTATAAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-211s21c1
Sequence:CCGGACATGATGACTGTCCTAATAACTCGAGTTATTAGGACAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017769.3-2372s21c1
Sequence:CCGGGTTAGCTTCTTGACCTAATAACTCGAGTTATTAGGTCAAGAAGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_017769.x-851s1c1
Sequence:CCGGCCTGATAGCAAATGGGAAATACTCGAGTATTTCCCATTTGCTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017769.x-5067s1c1
Sequence:CCGGGCCTTTAGCATTCAGTCATTACTCGAGTAATGACTGAATGCTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-2205s1c1
Sequence:CCGGGTTCTCATTACATTGGACATTCTCGAGAATGTCCAATGTAATGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-836s1c1
Sequence:CCGGCGAGACTATAATGCACCTGATCTCGAGATCAGGTGCATTATAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-609s1c1
Sequence:CCGGCTTGGTTTCATAGAGACTGTTCTCGAGAACAGTCTCTATGAAACCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017769
VALIDATED
G2E3 MISSION shRNA shRNA Plasmid DNA
G2/M-phase specific E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-2077s21c1
Sequence:CCGGCATTCCTCCAGCTGGATTTAACTCGAGTTAAATCCAGCTGGAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1409s21c1
Sequence:CCGGCATCTTGAGAACTCATCATTGCTCGAGCAATGATGAGTTCTCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-446s21c1
Sequence:CCGGTGTAAACGAAGTTATCATTTCCTCGAGGAAATGATAACTTCGTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1194s21c1
Sequence:CCGGCAACACTATTAATAGAGTTAGCTCGAGCTAACTCTATTAATAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-716s21c1
Sequence:CCGGAGGTGTACAATATGCAATAATCTCGAGATTATTGCATATTGTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1734s21c1
Sequence:CCGGTCAGACTTATAACGACATTAACTCGAGTTAATGTCGTTATAAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-211s21c1
Sequence:CCGGACATGATGACTGTCCTAATAACTCGAGTTATTAGGACAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017769.3-2372s21c1
Sequence:CCGGGTTAGCTTCTTGACCTAATAACTCGAGTTATTAGGTCAAGAAGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_017769.x-851s1c1
Sequence:CCGGCCTGATAGCAAATGGGAAATACTCGAGTATTTCCCATTTGCTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017769.x-5067s1c1
Sequence:CCGGGCCTTTAGCATTCAGTCATTACTCGAGTAATGACTGAATGCTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-2205s1c1
Sequence:CCGGGTTCTCATTACATTGGACATTCTCGAGAATGTCCAATGTAATGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-836s1c1
Sequence:CCGGCGAGACTATAATGCACCTGATCTCGAGATCAGGTGCATTATAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-609s1c1
Sequence:CCGGCTTGGTTTCATAGAGACTGTTCTCGAGAACAGTCTCTATGAAACCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017769
VALIDATED
G2E3 MISSION shRNA Lentiviral Transduction Particles
G2/M-phase specific E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-2077s21c1
Sequence:CCGGCATTCCTCCAGCTGGATTTAACTCGAGTTAAATCCAGCTGGAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1409s21c1
Sequence:CCGGCATCTTGAGAACTCATCATTGCTCGAGCAATGATGAGTTCTCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-446s21c1
Sequence:CCGGTGTAAACGAAGTTATCATTTCCTCGAGGAAATGATAACTTCGTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1194s21c1
Sequence:CCGGCAACACTATTAATAGAGTTAGCTCGAGCTAACTCTATTAATAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-716s21c1
Sequence:CCGGAGGTGTACAATATGCAATAATCTCGAGATTATTGCATATTGTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-1734s21c1
Sequence:CCGGTCAGACTTATAACGACATTAACTCGAGTTAATGTCGTTATAAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017769.3-211s21c1
Sequence:CCGGACATGATGACTGTCCTAATAACTCGAGTTATTAGGACAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017769.3-2372s21c1
Sequence:CCGGGTTAGCTTCTTGACCTAATAACTCGAGTTATTAGGTCAAGAAGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_017769.x-851s1c1
Sequence:CCGGCCTGATAGCAAATGGGAAATACTCGAGTATTTCCCATTTGCTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017769.x-5067s1c1
Sequence:CCGGGCCTTTAGCATTCAGTCATTACTCGAGTAATGACTGAATGCTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-2205s1c1
Sequence:CCGGGTTCTCATTACATTGGACATTCTCGAGAATGTCCAATGTAATGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-836s1c1
Sequence:CCGGCGAGACTATAATGCACCTGATCTCGAGATCAGGTGCATTATAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017769.x-609s1c1
Sequence:CCGGCTTGGTTTCATAGAGACTGTTCTCGAGAACAGTCTCTATGAAACCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015099
VALIDATED
G2E3 MISSION shRNA Bacterial Glycerol Stock
G2/M-phase specific E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001015099.1-2741s1c1
Sequence:CCGGGTAGAACAAGCTGTCAAATTACTCGAGTAATTTGACAGCTTGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-821s1c1
Sequence:CCGGCCGAGACTACAACGAACCTAACTCGAGTTAGGTTCGTTGTAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-958s1c1
Sequence:CCGGCCTACACTTCAGATTTCCAAACTCGAGTTTGGAAATCTGAAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-2155s1c1
Sequence:CCGGGAGACACTCTAAGATTAGAAACTCGAGTTTCTAATCTTAGAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-1962s1c1
Sequence:CCGGGCAACAACGATGGAAGATATTCTCGAGAATATCTTCCATCGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015099.1-478s1c1
Sequence:CCGGCCGTTCAAGCAATTACATCTACTCGAGTAGATGTAATTGCTTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015099
VALIDATED
G2E3 MISSION shRNA shRNA Plasmid DNA
G2/M-phase specific E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001015099.1-2741s1c1
Sequence:CCGGGTAGAACAAGCTGTCAAATTACTCGAGTAATTTGACAGCTTGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-821s1c1
Sequence:CCGGCCGAGACTACAACGAACCTAACTCGAGTTAGGTTCGTTGTAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-958s1c1
Sequence:CCGGCCTACACTTCAGATTTCCAAACTCGAGTTTGGAAATCTGAAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-2155s1c1
Sequence:CCGGGAGACACTCTAAGATTAGAAACTCGAGTTTCTAATCTTAGAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-1962s1c1
Sequence:CCGGGCAACAACGATGGAAGATATTCTCGAGAATATCTTCCATCGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015099.1-478s1c1
Sequence:CCGGCCGTTCAAGCAATTACATCTACTCGAGTAGATGTAATTGCTTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015099
VALIDATED
G2E3 MISSION shRNA Lentiviral Transduction Particles
G2/M-phase specific E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001015099.1-2741s1c1
Sequence:CCGGGTAGAACAAGCTGTCAAATTACTCGAGTAATTTGACAGCTTGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-821s1c1
Sequence:CCGGCCGAGACTACAACGAACCTAACTCGAGTTAGGTTCGTTGTAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-958s1c1
Sequence:CCGGCCTACACTTCAGATTTCCAAACTCGAGTTTGGAAATCTGAAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-2155s1c1
Sequence:CCGGGAGACACTCTAAGATTAGAAACTCGAGTTTCTAATCTTAGAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015099.1-1962s1c1
Sequence:CCGGGCAACAACGATGGAAGATATTCTCGAGAATATCTTCCATCGTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015099.1-478s1c1
Sequence:CCGGCCGTTCAAGCAATTACATCTACTCGAGTAGATGTAATTGCTTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks