EMAIL THIS PAGE TO A FRIEND

G3BP1

GTPase activating protein (SH3 domain) binding protein 1

154 Gene Product Result for
Synonyms: G3BP HDH-VIII
UniProtKB ID: Q13283
Gene ID:
Human(10146) Summary: This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(27041) GTPase activating protein (SH3 domain) binding protein 1
Rat(171092) GTPase activating protein (SH3 domain) binding protein 1
Zebrafish(335512) GTPase activating protein (SH3 domain) binding protein 1
chicken(416265) GTPase activating protein (SH3 domain) binding protein 1
domestic cat(101099615) GTPase activating protein (SH3 domain) binding protein 1
cow(534214) GTPase activating protein (SH3 domain) binding protein 1
dog(479322) GTPase activating protein (SH3 domain) binding protein 1
sheep(101106523) GTPase activating protein (SH3 domain) binding protein 1
domestic guinea pig(100725714) GTPase activating protein (SH3 domain) binding protein 1
naked mole-rat(101696790) GTPase activating protein (SH3 domain) binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22382A Anti-G3BP antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
G6046 Anti-G3BP antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse (predicted), rat (predicted)
immunofluorescence, western blot pricing
AV37713 Anti-G3BP antibody produced in rabbit IgG fraction of antiserum canine, mouse, horse, human, rat, guinea pig, bovine, rabbit
western blot pricing
SAB4500043 Anti-G3BP-1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300380 Anti-G3BP1 (Ab-232) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1406936 Anti-G3BP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA004052 Anti-G3BP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105138 Anti-G3BP1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, horse, mouse, rabbit, rat, guinea pig
western blot pricing
G8046 Anti-phospho-G3BP (pSer149) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse (predicted), rat (predicted)
western blot pricing
SAB4504411 Anti-phospho-G3BP-1 (pSer232) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300064 Anti-phospho-G3BP1 (pSer232) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
WH0010146M1 Monoclonal Anti-G3BP antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0231 Rabbit anti-G3BP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, rhesus monkey, primate, human, dog, horse, rabbit, rabbit, rabbit, marmoset, chimpanzee
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005754 Rosetta Predictions human pricing
NM_198395 Rosetta Predictions human pricing
XM_001074757 Rosetta Predictions rat pricing
XM_340802 Rosetta Predictions rat pricing
NM_013716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045798 predicted 670
2 SASI_Hs01_00045799 predicted 1224
3 SASI_Hs01_00045800 predicted 487
4 SASI_Hs01_00045801 predicted 1276
5 SASI_Hs01_00045803 predicted 644
6 SASI_Hs01_00045804 predicted 1594
7 SASI_Hs01_00045805 predicted 419
8 SASI_Hs01_00045806 predicted 872
9 SASI_Hs01_00045807 predicted 972
10 SASI_Hs02_00340224 predicted 917
11 SASI_Hs01_00045802 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242284 predicted 639
2 SASI_Hs01_00242285 predicted 1187
3 SASI_Hs01_00242286 predicted 448
4 SASI_Hs01_00242287 predicted 1242
5 SASI_Hs01_00242289 predicted 615
6 SASI_Hs01_00242290 predicted 1558
7 SASI_Hs01_00242291 predicted 389
8 SASI_Hs01_00242292 predicted 838
9 SASI_Hs01_00242293 predicted 938
10 SASI_Hs02_00371913 predicted 891
11 SASI_Hs01_00242288 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347264 predicted 1310
2 SASI_Rn02_00347265 predicted 1303
3 SASI_Rn02_00347266 predicted 515
4 SASI_Rn02_00347267 predicted 1252
5 SASI_Rn02_00347268 predicted 1572
6 SASI_Rn02_00347269 predicted 1628
7 SASI_Rn02_00347270 predicted 1657
8 SASI_Rn02_00347271 predicted 543
9 SASI_Rn02_00347272 predicted 224
10 SASI_Rn02_00347273 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391909 predicted 1311
2 SASI_Rn02_00391910 predicted 1303
3 SASI_Rn02_00391911 predicted 517
4 SASI_Rn02_00391912 predicted 1253
5 SASI_Rn02_00391913 predicted 1569
6 SASI_Rn02_00391914 predicted 1623
7 SASI_Rn02_00391915 predicted 1658
8 SASI_Rn02_00391916 predicted 546
9 SASI_Rn02_00391917 predicted 220
10 SASI_Rn02_00391918 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035130 predicted 1452
2 SASI_Mm02_00322625 predicted 224
3 SASI_Mm02_00322626 predicted 1513
4 SASI_Mm02_00322627 predicted 452
5 SASI_Mm02_00322628 predicted 809
6 SASI_Mm02_00322629 predicted 1457
7 SASI_Mm02_00322630 predicted 685
8 SASI_Mm02_00322631 predicted 1503
9 SASI_Mm01_00035128 predicted 421
10 SASI_Mm01_00035129 predicted 1177
11 SASI_Mm01_00035131 predicted 1170
12 SASI_Mm01_00035132 predicted 246
13 SASI_Mm01_00035133 predicted 1515
14 SASI_Mm01_00035134 predicted 1545
15 SASI_Mm01_00035135 predicted 580
16 SASI_Mm01_00035136 predicted 1116
17 SASI_Mm01_00035137 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005754
G3BP1 MISSION shRNA Bacterial Glycerol Stock
GTPase activating protein (SH3 domain) binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005754.2-1976s1c1
Sequence:CCGGGCCTGTAAGAAATACAGGATTCTCGAGAATCCTGTATTTCTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-1279s1c1
Sequence:CCGGCGCATTAACAGTGGTGGGAAACTCGAGTTTCCCACCACTGTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-477s1c1
Sequence:CCGGCCAGGCTTTGAGGAGATTCATCTCGAGATGAATCTCCTCAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-982s1c1
Sequence:CCGGCCACCTCATGTTGTTAAAGTACTCGAGTACTTTAACAACATGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-208s1c1
Sequence:CCGGCGGGAATTTGTGAGACAGTATCTCGAGATACTGTCTCACAAATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005754.2-1757s21c1
Sequence:CCGGTTAGTCTTTCACTTCCAATTTCTCGAGAAATTGGAAGTGAAAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-1429s21c1
Sequence:CCGGGAAGGCGACCGACGAGATAATCTCGAGATTATCTCGTCGGTCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-412s21c1
Sequence:CCGGGATGCTCATGCCACGCTAAATCTCGAGATTTAGCGTGGCATGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-1077s21c1
Sequence:CCGGAGTGCGAGAACAACGAATAAACTCGAGTTTATTCGTTGTTCTCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-566s21c1
Sequence:CCGGGATACCAAGATGAGGTCTTTGCTCGAGCAAAGACCTCATCTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005754
G3BP1 MISSION shRNA shRNA Plasmid DNA
GTPase activating protein (SH3 domain) binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005754.2-1976s1c1
Sequence:CCGGGCCTGTAAGAAATACAGGATTCTCGAGAATCCTGTATTTCTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-1279s1c1
Sequence:CCGGCGCATTAACAGTGGTGGGAAACTCGAGTTTCCCACCACTGTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-477s1c1
Sequence:CCGGCCAGGCTTTGAGGAGATTCATCTCGAGATGAATCTCCTCAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-982s1c1
Sequence:CCGGCCACCTCATGTTGTTAAAGTACTCGAGTACTTTAACAACATGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-208s1c1
Sequence:CCGGCGGGAATTTGTGAGACAGTATCTCGAGATACTGTCTCACAAATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005754.2-1757s21c1
Sequence:CCGGTTAGTCTTTCACTTCCAATTTCTCGAGAAATTGGAAGTGAAAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-1429s21c1
Sequence:CCGGGAAGGCGACCGACGAGATAATCTCGAGATTATCTCGTCGGTCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-412s21c1
Sequence:CCGGGATGCTCATGCCACGCTAAATCTCGAGATTTAGCGTGGCATGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-1077s21c1
Sequence:CCGGAGTGCGAGAACAACGAATAAACTCGAGTTTATTCGTTGTTCTCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-566s21c1
Sequence:CCGGGATACCAAGATGAGGTCTTTGCTCGAGCAAAGACCTCATCTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005754
G3BP1 MISSION shRNA Lentiviral Transduction Particles
GTPase activating protein (SH3 domain) binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005754.2-1976s1c1
Sequence:CCGGGCCTGTAAGAAATACAGGATTCTCGAGAATCCTGTATTTCTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-1279s1c1
Sequence:CCGGCGCATTAACAGTGGTGGGAAACTCGAGTTTCCCACCACTGTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-477s1c1
Sequence:CCGGCCAGGCTTTGAGGAGATTCATCTCGAGATGAATCTCCTCAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-982s1c1
Sequence:CCGGCCACCTCATGTTGTTAAAGTACTCGAGTACTTTAACAACATGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005754.2-208s1c1
Sequence:CCGGCGGGAATTTGTGAGACAGTATCTCGAGATACTGTCTCACAAATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005754.2-1757s21c1
Sequence:CCGGTTAGTCTTTCACTTCCAATTTCTCGAGAAATTGGAAGTGAAAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-1429s21c1
Sequence:CCGGGAAGGCGACCGACGAGATAATCTCGAGATTATCTCGTCGGTCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-412s21c1
Sequence:CCGGGATGCTCATGCCACGCTAAATCTCGAGATTTAGCGTGGCATGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-1077s21c1
Sequence:CCGGAGTGCGAGAACAACGAATAAACTCGAGTTTATTCGTTGTTCTCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005754.2-566s21c1
Sequence:CCGGGATACCAAGATGAGGTCTTTGCTCGAGCAAAGACCTCATCTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013716
VALIDATED
G3BP1 MISSION shRNA Bacterial Glycerol Stock
GTPase activating protein (SH3 domain) binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-566s1c1
Sequence:CCGGGCCTGATGATTCTGGAACTTTCTCGAGAAAGTTCCAGAATCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-1244s1c1
Sequence:CCGGCCTTAGTAATAGGCCCATCATCTCGAGATGATGGGCCTATTACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-951s1c1
Sequence:CCGGCCTCAGAGAGATCAGAGAGTTCTCGAGAACTCTCTGATCTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-239s1c1
Sequence:CCGGGCAGAAGGAAATCCACAGGAACTCGAGTTCCTGTGGATTTCCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013716.1-147s1c1
Sequence:CCGGCCGGACATGTTGCACAGATTTCTCGAGAAATCTGTGCAACATGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-566s21c1
Sequence:CCGGGCCTGATGATTCTGGAACTTTCTCGAGAAAGTTCCAGAATCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-951s21c1
Sequence:CCGGCCTCAGAGAGATCAGAGAGTTCTCGAGAACTCTCTGATCTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-1546s21c1
Sequence:CCGGTCTCGGAATAGTCTATTATAACTCGAGTTATAATAGACTATTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-1182s21c1
Sequence:CCGGGGTGGGAAGTTACCCAATTTCCTCGAGGAAATTGGGTAACTTCCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013716.2-813s21c1
Sequence:CCGGTGGGCATCTGTGACGAGTAAGCTCGAGCTTACTCGTCACAGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013716
VALIDATED
G3BP1 MISSION shRNA shRNA Plasmid DNA
GTPase activating protein (SH3 domain) binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-566s1c1
Sequence:CCGGGCCTGATGATTCTGGAACTTTCTCGAGAAAGTTCCAGAATCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-1244s1c1
Sequence:CCGGCCTTAGTAATAGGCCCATCATCTCGAGATGATGGGCCTATTACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-951s1c1
Sequence:CCGGCCTCAGAGAGATCAGAGAGTTCTCGAGAACTCTCTGATCTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-239s1c1
Sequence:CCGGGCAGAAGGAAATCCACAGGAACTCGAGTTCCTGTGGATTTCCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013716.1-147s1c1
Sequence:CCGGCCGGACATGTTGCACAGATTTCTCGAGAAATCTGTGCAACATGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-566s21c1
Sequence:CCGGGCCTGATGATTCTGGAACTTTCTCGAGAAAGTTCCAGAATCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-951s21c1
Sequence:CCGGCCTCAGAGAGATCAGAGAGTTCTCGAGAACTCTCTGATCTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-1546s21c1
Sequence:CCGGTCTCGGAATAGTCTATTATAACTCGAGTTATAATAGACTATTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-1182s21c1
Sequence:CCGGGGTGGGAAGTTACCCAATTTCCTCGAGGAAATTGGGTAACTTCCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013716.2-813s21c1
Sequence:CCGGTGGGCATCTGTGACGAGTAAGCTCGAGCTTACTCGTCACAGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013716
VALIDATED
G3BP1 MISSION shRNA Lentiviral Transduction Particles
GTPase activating protein (SH3 domain) binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-566s1c1
Sequence:CCGGGCCTGATGATTCTGGAACTTTCTCGAGAAAGTTCCAGAATCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-1244s1c1
Sequence:CCGGCCTTAGTAATAGGCCCATCATCTCGAGATGATGGGCCTATTACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-951s1c1
Sequence:CCGGCCTCAGAGAGATCAGAGAGTTCTCGAGAACTCTCTGATCTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013716.1-239s1c1
Sequence:CCGGGCAGAAGGAAATCCACAGGAACTCGAGTTCCTGTGGATTTCCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013716.1-147s1c1
Sequence:CCGGCCGGACATGTTGCACAGATTTCTCGAGAAATCTGTGCAACATGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-566s21c1
Sequence:CCGGGCCTGATGATTCTGGAACTTTCTCGAGAAAGTTCCAGAATCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-951s21c1
Sequence:CCGGCCTCAGAGAGATCAGAGAGTTCTCGAGAACTCTCTGATCTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-1546s21c1
Sequence:CCGGTCTCGGAATAGTCTATTATAACTCGAGTTATAATAGACTATTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013716.2-1182s21c1
Sequence:CCGGGGTGGGAAGTTACCCAATTTCCTCGAGGAAATTGGGTAACTTCCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013716.2-813s21c1
Sequence:CCGGTGGGCATCTGTGACGAGTAAGCTCGAGCTTACTCGTCACAGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks