EMAIL THIS PAGE TO A FRIEND

G3BP2

GTPase activating protein (SH3 domain) binding protein 2

262 Gene Product Result for
UniProtKB ID: Q9UN86, A8K6X1, O60606, O75149, Q9UPA1
Gene ID:
Mouse(23881) GTPase activating protein (SH3 domain) binding protein 2
Rat(305240) GTPase activating protein (SH3 domain) binding protein 2
naked mole-rat(101697508) GTPase activating protein (SH3 domain) binding protein 2
domestic guinea pig(100718027) GTPase activating protein (SH3 domain) binding protein 2
sheep(101107022) GTPase activating protein (SH3 domain) binding protein 2
Domestic Rabbit(100353618) GTPase activating protein (SH3 domain) binding protein 2
Zebrafish(556409) GTPase activating protein (SH3 domain) binding protein 2
cow(539249) GTPase activating protein (SH3 domain) binding protein 2
Horse(100050765) GTPase activating protein (SH3 domain) binding protein 2
chicken(422576) GTPase activating protein (SH3 domain) binding protein 2
domestic cat(101101133) GTPase activating protein (SH3 domain) binding protein 2
dog(478429) GTPase activating protein (SH3 domain) binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012297 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012297 Rosetta Predictions human pricing
NM_203504 Rosetta Predictions human pricing
NM_203505 Rosetta Predictions human pricing
NM_001013989 Rosetta Predictions rat pricing
NM_001080794 Rosetta Predictions mouse pricing
NM_001080795 Rosetta Predictions mouse pricing
NM_001080796 Rosetta Predictions mouse pricing
NM_001080797 Rosetta Predictions mouse pricing
NM_011816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054722 predicted 1277
2 SASI_Hs01_00054723 predicted 1175
3 SASI_Hs01_00054724 predicted 317
4 SASI_Hs01_00054725 predicted 1289
5 SASI_Hs01_00054726 predicted 1406
6 SASI_Hs01_00054727 predicted 165
7 SASI_Hs01_00054728 predicted 427
8 SASI_Hs01_00054729 predicted 646
9 SASI_Hs01_00054730 predicted 714
10 SASI_Hs01_00054731 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039925 predicted 1277
2 SASI_Hs01_00039926 predicted 1168
3 SASI_Hs01_00039927 predicted 418
4 SASI_Hs01_00039928 predicted 1282
5 SASI_Hs01_00039929 predicted 1410
6 SASI_Hs01_00039930 predicted 256
7 SASI_Hs01_00039931 predicted 531
8 SASI_Hs01_00039932 predicted 740
9 SASI_Hs01_00039933 predicted 809
10 SASI_Hs01_00039934 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112264 predicted 1372
2 SASI_Hs01_00112265 predicted 1266
3 SASI_Hs01_00112266 predicted 423
4 SASI_Hs01_00112267 predicted 1379
5 SASI_Hs01_00112268 predicted 1503
6 SASI_Hs01_00112269 predicted 258
7 SASI_Hs01_00112270 predicted 525
8 SASI_Hs01_00112271 predicted 741
9 SASI_Hs01_00112272 predicted 812
10 SASI_Hs01_00112273 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082600 predicted 1544
2 SASI_Rn01_00082601 predicted 639
3 SASI_Rn01_00082602 predicted 1422
4 SASI_Rn02_00201342 predicted 723
5 SASI_Rn01_00082604 predicted 1497
6 SASI_Rn01_00082605 predicted 567
7 SASI_Rn01_00082606 predicted 420
8 SASI_Rn01_00082607 predicted 1553
9 SASI_Rn01_00082608 predicted 439
10 SASI_Rn02_00201343 predicted 697
11 SASI_Rn01_00082603 predicted 493
12 SASI_Rn01_00082609 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293773 predicted 496
2 SASI_Mm02_00293774 predicted 592
3 SASI_Mm02_00293775 predicted 1380
4 SASI_Mm02_00293776 predicted 1275
5 SASI_Mm02_00293777 predicted 1737
6 SASI_Mm02_00293778 predicted 1517
7 SASI_Mm02_00293779 predicted 537
8 SASI_Mm02_00293780 predicted 1402
9 SASI_Mm02_00293781 predicted 642
10 SASI_Mm02_00293782 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293783 predicted 479
2 SASI_Mm02_00293784 predicted 576
3 SASI_Mm02_00293785 predicted 1269
4 SASI_Mm02_00293786 predicted 1164
5 SASI_Mm02_00293787 predicted 1624
6 SASI_Mm02_00293788 predicted 1405
7 SASI_Mm02_00293789 predicted 515
8 SASI_Mm02_00293790 predicted 1281
9 SASI_Mm02_00293791 predicted 625
10 SASI_Mm02_00293792 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293793 predicted 501
2 SASI_Mm02_00293794 predicted 586
3 SASI_Mm02_00293795 predicted 1289
4 SASI_Mm02_00293796 predicted 1182
5 SASI_Mm02_00293797 predicted 1641
6 SASI_Mm02_00293798 predicted 1418
7 SASI_Mm02_00293799 predicted 534
8 SASI_Mm02_00293800 predicted 1296
9 SASI_Mm02_00293801 predicted 643
10 SASI_Mm02_00293802 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293803 predicted 444
2 SASI_Mm02_00293804 predicted 537
3 SASI_Mm02_00293805 predicted 1327
4 SASI_Mm02_00293806 predicted 1219
5 SASI_Mm02_00293807 predicted 1678
6 SASI_Mm02_00293808 predicted 1461
7 SASI_Mm02_00293809 predicted 476
8 SASI_Mm02_00293810 predicted 1341
9 SASI_Mm02_00293811 predicted 593
10 SASI_Mm02_00293812 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139573 predicted 486
2 SASI_Mm02_00321511 predicted 579
3 SASI_Mm01_00139575 predicted 1365
4 SASI_Mm01_00139578 predicted 1265
5 SASI_Mm01_00139581 predicted 1720
6 SASI_Mm01_00139582 predicted 1501
7 SASI_Mm02_00321512 predicted 515
8 SASI_Mm02_00321513 predicted 1385
9 SASI_Mm02_00321514 predicted 627
10 SASI_Mm02_00321515 predicted 1642
11 SASI_Mm01_00139574 predicted 346
12 SASI_Mm01_00139576 predicted 276
13 SASI_Mm01_00139577 predicted 501
14 SASI_Mm01_00139579 predicted 211
15 SASI_Mm01_00139580 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012297
G3BP2 MISSION shRNA Bacterial Glycerol Stock
GTPase activating protein (SH3 domain) binding protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-1117s21c1
Sequence:CCGGGACTCTGACAACCGTAGAATACTCGAGTATTCTACGGTTGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1865s21c1
Sequence:CCGGTCTACGACAAAGTGAACTTAACTCGAGTTAAGTTCACTTTGTCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1755s21c1
Sequence:CCGGTAAATTGAGGTGGACATTATTCTCGAGAATAATGTCCACCTCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-1427s21c1
Sequence:CCGGGTGATGATCGCAGGGATATTACTCGAGTAATATCCCTGCGATCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-544s21c1
Sequence:CCGGCACAATGATATGTTTCGTTATCTCGAGATAACGAAACATATCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-513s21c1
Sequence:CCGGTGAAGGATCTGTTCCAAATAACTCGAGTTATTTGGAACAGATCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1645s21c1
Sequence:CCGGGTACATTATTCATCGTGTTTGCTCGAGCAAACACGATGAATAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-177s1c1
Sequence:CCGGCGGGAGTTTGTGAGGCAATATCTCGAGATATTGCCTCACAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-1221s1c1
Sequence:CCGGCGCATCAATACCAAGGGTGTTCTCGAGAACACCCTTGGTATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-450s1c1
Sequence:CCGGCCAGAAAGAAAGTTTATGCAACTCGAGTTGCATAAACTTTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-219s1c1
Sequence:CCGGCCGGAATATTTACACAGGTTTCTCGAGAAACCTGTGTAAATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-326s1c1
Sequence:CCGGCCACAAAGTATTATCTCTGAACTCGAGTTCAGAGATAATACTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012297
G3BP2 MISSION shRNA shRNA Plasmid DNA
GTPase activating protein (SH3 domain) binding protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-1117s21c1
Sequence:CCGGGACTCTGACAACCGTAGAATACTCGAGTATTCTACGGTTGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1865s21c1
Sequence:CCGGTCTACGACAAAGTGAACTTAACTCGAGTTAAGTTCACTTTGTCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1755s21c1
Sequence:CCGGTAAATTGAGGTGGACATTATTCTCGAGAATAATGTCCACCTCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-1427s21c1
Sequence:CCGGGTGATGATCGCAGGGATATTACTCGAGTAATATCCCTGCGATCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-544s21c1
Sequence:CCGGCACAATGATATGTTTCGTTATCTCGAGATAACGAAACATATCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-513s21c1
Sequence:CCGGTGAAGGATCTGTTCCAAATAACTCGAGTTATTTGGAACAGATCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1645s21c1
Sequence:CCGGGTACATTATTCATCGTGTTTGCTCGAGCAAACACGATGAATAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-177s1c1
Sequence:CCGGCGGGAGTTTGTGAGGCAATATCTCGAGATATTGCCTCACAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-1221s1c1
Sequence:CCGGCGCATCAATACCAAGGGTGTTCTCGAGAACACCCTTGGTATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-450s1c1
Sequence:CCGGCCAGAAAGAAAGTTTATGCAACTCGAGTTGCATAAACTTTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-219s1c1
Sequence:CCGGCCGGAATATTTACACAGGTTTCTCGAGAAACCTGTGTAAATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-326s1c1
Sequence:CCGGCCACAAAGTATTATCTCTGAACTCGAGTTCAGAGATAATACTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012297
G3BP2 MISSION shRNA Lentiviral Transduction Particles
GTPase activating protein (SH3 domain) binding protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-1117s21c1
Sequence:CCGGGACTCTGACAACCGTAGAATACTCGAGTATTCTACGGTTGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1865s21c1
Sequence:CCGGTCTACGACAAAGTGAACTTAACTCGAGTTAAGTTCACTTTGTCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1755s21c1
Sequence:CCGGTAAATTGAGGTGGACATTATTCTCGAGAATAATGTCCACCTCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-1427s21c1
Sequence:CCGGGTGATGATCGCAGGGATATTACTCGAGTAATATCCCTGCGATCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-544s21c1
Sequence:CCGGCACAATGATATGTTTCGTTATCTCGAGATAACGAAACATATCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012297.4-513s21c1
Sequence:CCGGTGAAGGATCTGTTCCAAATAACTCGAGTTATTTGGAACAGATCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012297.4-1645s21c1
Sequence:CCGGGTACATTATTCATCGTGTTTGCTCGAGCAAACACGATGAATAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-177s1c1
Sequence:CCGGCGGGAGTTTGTGAGGCAATATCTCGAGATATTGCCTCACAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-1221s1c1
Sequence:CCGGCGCATCAATACCAAGGGTGTTCTCGAGAACACCCTTGGTATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-450s1c1
Sequence:CCGGCCAGAAAGAAAGTTTATGCAACTCGAGTTGCATAAACTTTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-219s1c1
Sequence:CCGGCCGGAATATTTACACAGGTTTCTCGAGAAACCTGTGTAAATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012297.3-326s1c1
Sequence:CCGGCCACAAAGTATTATCTCTGAACTCGAGTTCAGAGATAATACTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011816
VALIDATED
G3BP2 MISSION shRNA Bacterial Glycerol Stock
GTPase activating protein (SH3 domain) binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-300s21c1
Sequence:GTACCGGGAATAAAGCTCCCGAGTATTTCTCGAGAAATACTCGGGAGCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-2846s21c1
Sequence:CCGGAGCTCCAGTGTGAACTATAAACTCGAGTTTATAGTTCACACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-1418s21c1
Sequence:CCGGTTCGAGGAGAAGTACGTTTAACTCGAGTTAAACGTACTTCTCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-1183s21c1
Sequence:CCGGGACTCTGACAACCGGAGAATACTCGAGTATTCTCCGGTTGTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-270s21c1
Sequence:CCGGGGAGTTTGTGAGGCAATATTACTCGAGTAATATTGCCTCACAAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-1748s1c1
Sequence:CCGGAGTTAAATTGAGGTGGACATTCTCGAGAATGTCCACCTCAATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011816.2-1341s1c1
Sequence:CCGGCCAATTATGTTTCGAGGAGAACTCGAGTTCTCCTCGAAACATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011816.2-230s1c1
Sequence:CCGGGCTGAATAAAGCTCCCGAGTACTCGAGTACTCGGGAGCTTTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-671s1c1
Sequence:CCGGGAATGCTAACAGCGCTTACTACTCGAGTAGTAAGCGCTGTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-1124s1c1
Sequence:CCGGCAACCGGAGAATAATTCGCTACTCGAGTAGCGAATTATTCTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011816
VALIDATED
G3BP2 MISSION shRNA shRNA Plasmid DNA
GTPase activating protein (SH3 domain) binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-300s21c1
Sequence:GTACCGGGAATAAAGCTCCCGAGTATTTCTCGAGAAATACTCGGGAGCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-2846s21c1
Sequence:CCGGAGCTCCAGTGTGAACTATAAACTCGAGTTTATAGTTCACACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-1418s21c1
Sequence:CCGGTTCGAGGAGAAGTACGTTTAACTCGAGTTAAACGTACTTCTCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-1183s21c1
Sequence:CCGGGACTCTGACAACCGGAGAATACTCGAGTATTCTCCGGTTGTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-270s21c1
Sequence:CCGGGGAGTTTGTGAGGCAATATTACTCGAGTAATATTGCCTCACAAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-1748s1c1
Sequence:CCGGAGTTAAATTGAGGTGGACATTCTCGAGAATGTCCACCTCAATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011816.2-1341s1c1
Sequence:CCGGCCAATTATGTTTCGAGGAGAACTCGAGTTCTCCTCGAAACATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011816.2-230s1c1
Sequence:CCGGGCTGAATAAAGCTCCCGAGTACTCGAGTACTCGGGAGCTTTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-671s1c1
Sequence:CCGGGAATGCTAACAGCGCTTACTACTCGAGTAGTAAGCGCTGTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-1124s1c1
Sequence:CCGGCAACCGGAGAATAATTCGCTACTCGAGTAGCGAATTATTCTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011816
VALIDATED
G3BP2 MISSION shRNA Lentiviral Transduction Particles
GTPase activating protein (SH3 domain) binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-300s21c1
Sequence:GTACCGGGAATAAAGCTCCCGAGTATTTCTCGAGAAATACTCGGGAGCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-2846s21c1
Sequence:CCGGAGCTCCAGTGTGAACTATAAACTCGAGTTTATAGTTCACACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-1418s21c1
Sequence:CCGGTTCGAGGAGAAGTACGTTTAACTCGAGTTAAACGTACTTCTCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-1183s21c1
Sequence:CCGGGACTCTGACAACCGGAGAATACTCGAGTATTCTCCGGTTGTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011816.3-270s21c1
Sequence:CCGGGGAGTTTGTGAGGCAATATTACTCGAGTAATATTGCCTCACAAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-1748s1c1
Sequence:CCGGAGTTAAATTGAGGTGGACATTCTCGAGAATGTCCACCTCAATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011816.2-1341s1c1
Sequence:CCGGCCAATTATGTTTCGAGGAGAACTCGAGTTCTCCTCGAAACATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011816.2-230s1c1
Sequence:CCGGGCTGAATAAAGCTCCCGAGTACTCGAGTACTCGGGAGCTTTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-671s1c1
Sequence:CCGGGAATGCTAACAGCGCTTACTACTCGAGTAGTAAGCGCTGTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011816.2-1124s1c1
Sequence:CCGGCAACCGGAGAATAATTCGCTACTCGAGTAGCGAATTATTCTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks