EMAIL THIS PAGE TO A FRIEND

G6PC2

glucose-6-phosphatase, catalytic, 2

129 Gene Product Result for
Synonyms: IGRP
UniProtKB ID: Q9NQR9, E9PAX2, Q6AHZ0
Gene ID:
Human(57818) Summary: This gene encodes an enzyme belonging to the glucose-6-phosphatase catalytic subunit family. These enzymes are part of a multicomponent integral membrane system that catalyzes the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, allowing the release of glucose into the bloodstream. The family member encoded by this gene is found in pancreatic islets and does not exhibit phosphohydrolase activity, but it is a major target of cell-mediated autoimmunity in diabetes. Several alternatively spliced transcript variants of this gene have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(14378) glucose-6-phosphatase, catalytic, 2
Rat(170505) glucose-6-phosphatase, catalytic, 2
sheep(101121493) glucose-6-phosphatase, catalytic, 2
naked mole-rat(101715644) glucose-6-phosphatase, catalytic, 2
domestic guinea pig(100736161) glucose-6-phosphatase, catalytic, 2
chicken(424171) glucose-6-phosphatase, catalytic, 2
dog(488389) glucose-6-phosphatase, catalytic, 2
domestic cat(101085486) glucose-6-phosphatase, catalytic, 2
Horse(100062750) glucose-6-phosphatase, catalytic, 2
cow(505012) glucose-6-phosphatase, catalytic, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301158 ANTI-G6PC2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149951 MISSION® esiRNA esiRNA human G6PC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081686 Rosetta Predictions human pricing
NM_021176 Rosetta Predictions human pricing
NM_021331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316543 predicted 301
2 SASI_Hs02_00316544 predicted 1036
3 SASI_Hs02_00316545 predicted 716
4 SASI_Hs02_00316546 predicted 325
5 SASI_Hs02_00316547 predicted 965
6 SASI_Hs02_00316548 predicted 995
7 SASI_Hs02_00316549 predicted 1053
8 SASI_Hs02_00316550 predicted 346
9 SASI_Hs02_00316551 predicted 513
10 SASI_Hs02_00316552 predicted 104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044268 predicted 307
2 SASI_Hs01_00044266 predicted 596
3 SASI_Hs02_00354738 predicted 1149
4 SASI_Hs01_00044270 predicted 328
5 SASI_Hs02_00354739 predicted 1079
6 SASI_Hs01_00044271 predicted 356
7 SASI_Hs01_00044274 predicted 592
8 SASI_Hs02_00354740 predicted 1172
9 SASI_Hs02_00354741 predicted 583
10 SASI_Hs02_00354742 predicted 756
11 SASI_Hs01_00044267 predicted 813
12 SASI_Hs01_00044269 predicted 437
13 SASI_Hs01_00044272 predicted 619
14 SASI_Hs01_00044273 predicted 584
15 SASI_Hs01_00044275 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097005 predicted 273
2 SASI_Mm01_00097006 predicted 779
3 SASI_Mm02_00325908 predicted 592
4 SASI_Mm01_00097008 predicted 934
5 SASI_Mm01_00097009 predicted 287
6 SASI_Mm01_00097010 predicted 1054
7 SASI_Mm01_00097011 predicted 523
8 SASI_Mm01_00097012 predicted 261
9 SASI_Mm01_00097014 predicted 281
10 SASI_Mm02_00325909 predicted 533
11 SASI_Mm01_00097007 predicted 325
12 SASI_Mm01_00097013 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021176
G6PC2 MISSION shRNA Bacterial Glycerol Stock
glucose-6-phosphatase, catalytic, 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021176.2-1634s21c1
Sequence:CCGGGAGGAAATGGAAGCCTATTTACTCGAGTAAATAGGCTTCCATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021176.2-1030s21c1
Sequence:CCGGCGACTCACGAAGAGCATTTATCTCGAGATAAATGCTCTTCGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021176.2-999s21c1
Sequence:CCGGATACTGCAGCTCTACCATTTCCTCGAGGAAATGGTAGAGCTGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021176.2-1334s21c1
Sequence:CCGGATCCTTCAGTTACCAATATTTCTCGAGAAATATTGGTAACTGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-503s1c1
Sequence:CCGGGAGTATTCATAGCAACACATTCTCGAGAATGTGTTGCTATGAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-311s1c1
Sequence:CCGGCATGTGAAACAGGTCCAGGAACTCGAGTTCCTGGACCTGTTTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-810s1c1
Sequence:CCGGCTTTGCAATCAACTCAGAGATCTCGAGATCTCTGAGTTGATTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-666s1c1
Sequence:CCGGCCTGCTTCTTAGGGTGCTCAACTCGAGTTGAGCACCCTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-54s1c1
Sequence:CCGGCTACCGAGCTTACTACACTTTCTCGAGAAAGTGTAGTAAGCTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021176
G6PC2 MISSION shRNA shRNA Plasmid DNA
glucose-6-phosphatase, catalytic, 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021176.2-1634s21c1
Sequence:CCGGGAGGAAATGGAAGCCTATTTACTCGAGTAAATAGGCTTCCATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021176.2-1030s21c1
Sequence:CCGGCGACTCACGAAGAGCATTTATCTCGAGATAAATGCTCTTCGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021176.2-999s21c1
Sequence:CCGGATACTGCAGCTCTACCATTTCCTCGAGGAAATGGTAGAGCTGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021176.2-1334s21c1
Sequence:CCGGATCCTTCAGTTACCAATATTTCTCGAGAAATATTGGTAACTGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-503s1c1
Sequence:CCGGGAGTATTCATAGCAACACATTCTCGAGAATGTGTTGCTATGAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-311s1c1
Sequence:CCGGCATGTGAAACAGGTCCAGGAACTCGAGTTCCTGGACCTGTTTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-810s1c1
Sequence:CCGGCTTTGCAATCAACTCAGAGATCTCGAGATCTCTGAGTTGATTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-666s1c1
Sequence:CCGGCCTGCTTCTTAGGGTGCTCAACTCGAGTTGAGCACCCTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-54s1c1
Sequence:CCGGCTACCGAGCTTACTACACTTTCTCGAGAAAGTGTAGTAAGCTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021176
G6PC2 MISSION shRNA Lentiviral Transduction Particles
glucose-6-phosphatase, catalytic, 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021176.2-1634s21c1
Sequence:CCGGGAGGAAATGGAAGCCTATTTACTCGAGTAAATAGGCTTCCATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021176.2-1030s21c1
Sequence:CCGGCGACTCACGAAGAGCATTTATCTCGAGATAAATGCTCTTCGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021176.2-999s21c1
Sequence:CCGGATACTGCAGCTCTACCATTTCCTCGAGGAAATGGTAGAGCTGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021176.2-1334s21c1
Sequence:CCGGATCCTTCAGTTACCAATATTTCTCGAGAAATATTGGTAACTGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-503s1c1
Sequence:CCGGGAGTATTCATAGCAACACATTCTCGAGAATGTGTTGCTATGAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-311s1c1
Sequence:CCGGCATGTGAAACAGGTCCAGGAACTCGAGTTCCTGGACCTGTTTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-810s1c1
Sequence:CCGGCTTTGCAATCAACTCAGAGATCTCGAGATCTCTGAGTTGATTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-666s1c1
Sequence:CCGGCCTGCTTCTTAGGGTGCTCAACTCGAGTTGAGCACCCTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021176.1-54s1c1
Sequence:CCGGCTACCGAGCTTACTACACTTTCTCGAGAAAGTGTAGTAAGCTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021331
G6PC2 MISSION shRNA Bacterial Glycerol Stock
glucose-6-phosphatase, catalytic, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021331.1-1471s1c1
Sequence:CCGGGCTGATGTTTCTATCATCTTACTCGAGTAAGATGATAGAAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-1109s1c1
Sequence:CCGGCGGTGACAAGAAGACTAAATACTCGAGTATTTAGTCTTCTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-191s1c1
Sequence:CCGGCCCACTTTGGTTTCAGTTGAACTCGAGTTCAACTGAAACCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-192s1c1
Sequence:CCGGCCACTTTGGTTTCAGTTGAATCTCGAGATTCAACTGAAACCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-424s1c1
Sequence:CCGGGCGTCTGGTATGTCATGGTAACTCGAGTTACCATGACATACCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021331
G6PC2 MISSION shRNA shRNA Plasmid DNA
glucose-6-phosphatase, catalytic, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021331.1-1471s1c1
Sequence:CCGGGCTGATGTTTCTATCATCTTACTCGAGTAAGATGATAGAAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-1109s1c1
Sequence:CCGGCGGTGACAAGAAGACTAAATACTCGAGTATTTAGTCTTCTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-191s1c1
Sequence:CCGGCCCACTTTGGTTTCAGTTGAACTCGAGTTCAACTGAAACCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-192s1c1
Sequence:CCGGCCACTTTGGTTTCAGTTGAATCTCGAGATTCAACTGAAACCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-424s1c1
Sequence:CCGGGCGTCTGGTATGTCATGGTAACTCGAGTTACCATGACATACCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021331
G6PC2 MISSION shRNA Lentiviral Transduction Particles
glucose-6-phosphatase, catalytic, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021331.1-1471s1c1
Sequence:CCGGGCTGATGTTTCTATCATCTTACTCGAGTAAGATGATAGAAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-1109s1c1
Sequence:CCGGCGGTGACAAGAAGACTAAATACTCGAGTATTTAGTCTTCTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-191s1c1
Sequence:CCGGCCCACTTTGGTTTCAGTTGAACTCGAGTTCAACTGAAACCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-192s1c1
Sequence:CCGGCCACTTTGGTTTCAGTTGAATCTCGAGATTCAACTGAAACCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021331.1-424s1c1
Sequence:CCGGGCGTCTGGTATGTCATGGTAACTCGAGTTACCATGACATACCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks